ID: 1077224376

View in Genome Browser
Species Human (GRCh38)
Location 11:1433688-1433710
Sequence GATTATGGATGAAGGGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077224362_1077224376 28 Left 1077224362 11:1433637-1433659 CCAGCCTCGTGCCTGGGGAGGGA 0: 1
1: 0
2: 2
3: 31
4: 287
Right 1077224376 11:1433688-1433710 GATTATGGATGAAGGGCTCTAGG 0: 1
1: 0
2: 0
3: 7
4: 119
1077224363_1077224376 24 Left 1077224363 11:1433641-1433663 CCTCGTGCCTGGGGAGGGATGCG 0: 1
1: 0
2: 0
3: 14
4: 182
Right 1077224376 11:1433688-1433710 GATTATGGATGAAGGGCTCTAGG 0: 1
1: 0
2: 0
3: 7
4: 119
1077224365_1077224376 17 Left 1077224365 11:1433648-1433670 CCTGGGGAGGGATGCGCTGTGGG 0: 1
1: 0
2: 2
3: 22
4: 256
Right 1077224376 11:1433688-1433710 GATTATGGATGAAGGGCTCTAGG 0: 1
1: 0
2: 0
3: 7
4: 119
1077224368_1077224376 -8 Left 1077224368 11:1433673-1433695 CCTCCAGCCGCCCTGGATTATGG 0: 1
1: 0
2: 2
3: 5
4: 107
Right 1077224376 11:1433688-1433710 GATTATGGATGAAGGGCTCTAGG 0: 1
1: 0
2: 0
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077224376 Original CRISPR GATTATGGATGAAGGGCTCT AGG Intronic
900307060 1:2015677-2015699 GTGTAGGGATCAAGGGCTCTGGG + Intergenic
900715596 1:4141537-4141559 GCTGATGGATGAAGGTTTCTCGG - Intergenic
901602713 1:10434429-10434451 CATGAAGGGTGAAGGGCTCTGGG + Intronic
905236542 1:36554028-36554050 GATTACGGACCAGGGGCTCTGGG + Intergenic
908124469 1:61016566-61016588 GATCATGAATCAAGGGCTATGGG - Intronic
910168251 1:84350847-84350869 GATTAAGGATTAAGGTCTCCTGG + Intronic
917426012 1:174914837-174914859 GATTAGGGGTGAATGGATCTGGG - Intronic
920664085 1:207947366-207947388 GATTATGGGAGAAGGGCTCGAGG - Intergenic
924013008 1:239686536-239686558 AAATATGAAGGAAGGGCTCTGGG - Intronic
924136716 1:240974687-240974709 AATTATGGAAGAAAGGCTCATGG + Intronic
1067175363 10:43942189-43942211 GAGTATGGCTGCAGGGCTCCTGG + Intergenic
1068680445 10:59813905-59813927 ACTTAAGGAGGAAGGGCTCTGGG + Intronic
1071416341 10:85445173-85445195 GATTAGGGATGGAGGTGTCTGGG + Intergenic
1074555344 10:114484141-114484163 GAATATGAGTGAAGGGCTCACGG + Intronic
1077224376 11:1433688-1433710 GATTATGGATGAAGGGCTCTAGG + Intronic
1087541290 11:99523947-99523969 GATTATGGAAGAAGTAGTCTGGG - Intronic
1089018439 11:115186647-115186669 GATTGTTAAGGAAGGGCTCTTGG - Intronic
1090047974 11:123352758-123352780 GTGTATGGATTAAGGGGTCTAGG - Intergenic
1095915425 12:47473294-47473316 GATCATCTATGAGGGGCTCTTGG - Intergenic
1103000553 12:117382450-117382472 CAGTAGGGATGAAAGGCTCTGGG + Intronic
1105616064 13:22013758-22013780 GATGATGGAGAAAGGGCTCCTGG + Intergenic
1105918379 13:24938655-24938677 GATTATAGTTGAAGGGCTAGTGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107685417 13:42892657-42892679 GAGTTTGGAGGAAGGGGTCTGGG + Intronic
1109998619 13:70164760-70164782 GAAGATGGATAAAGGGCTCCAGG - Intergenic
1111989919 13:95106195-95106217 GATGATTTATGTAGGGCTCTAGG - Intronic
1112349465 13:98620907-98620929 CATTATAAATGAAGGGGTCTGGG - Intergenic
1122276780 14:100594759-100594781 GGTGATGCATAAAGGGCTCTGGG - Intergenic
1122328826 14:100899383-100899405 GAGTAACGATGAGGGGCTCTGGG + Intergenic
1122868690 14:104623399-104623421 GATTCTTCAAGAAGGGCTCTTGG - Intergenic
1124065376 15:26338377-26338399 GATTCTGCAGGAAGGGCTCCTGG + Intergenic
1125070889 15:35551533-35551555 AATTATGAATGTAGGGGTCTTGG - Intergenic
1127331443 15:57943861-57943883 GTTGCTGGATGAATGGCTCTGGG - Intergenic
1127962704 15:63901663-63901685 GACTCTGGATGGAGGGCTCCTGG - Intergenic
1131209209 15:90479101-90479123 GATCATGCATGAAGCTCTCTGGG + Intronic
1133679354 16:8106477-8106499 GGTTAAGGGTGAAGGGTTCTAGG + Intergenic
1133732819 16:8590679-8590701 GATTTTGGAGGAAGGGTACTTGG - Intergenic
1133824973 16:9270267-9270289 GATTATGAAGGAAGAGATCTGGG + Intergenic
1134809537 16:17155558-17155580 GACCATGGATGATGGGCTATAGG + Intronic
1135388766 16:22070419-22070441 CATAATGGATCAAGGACTCTAGG + Intronic
1135786155 16:25351090-25351112 GGATATGGAGAAAGGGCTCTGGG - Intergenic
1140474183 16:75230370-75230392 GAAAATGGCTGAAGGGCACTGGG + Intronic
1147041777 17:37725163-37725185 GCTTATGGGAGAAGTGCTCTTGG - Intronic
1154065504 18:11103394-11103416 GATTATGAGTGAATGGATCTTGG - Intronic
1155390827 18:25334819-25334841 TATTCTGGATGAAGTTCTCTGGG - Intronic
1155486159 18:26345171-26345193 GATTGTGGGTGCAGGGCTGTTGG - Intronic
1158960454 18:62583827-62583849 GTTAAAGGATGAGGGGCTCTGGG + Intronic
1160106888 18:75986811-75986833 GATTAAAGATGAAGAGGTCTGGG - Intergenic
1160328445 18:77970433-77970455 GATGATGGCTGAGTGGCTCTGGG + Intergenic
1166643675 19:44515286-44515308 GATCATGTATGAAGGTCTCTTGG - Intronic
926409636 2:12589818-12589840 GCTTCTAGATGAAGGACTCTTGG - Intergenic
927449131 2:23191376-23191398 GATTATAAAAGAAGGGCACTAGG + Intergenic
927615524 2:24589885-24589907 GATTCTGGATGAAGGATTGTGGG - Intronic
931234999 2:60405828-60405850 CAGTAAGGATGAAGGGCTATGGG + Intergenic
936508758 2:113128976-113128998 GCTAATGGAGGAAAGGCTCTAGG + Intronic
937364111 2:121248602-121248624 GATTATGGGTAAAGGACTGTGGG + Intronic
939936654 2:148301101-148301123 GCTTATGAATGAAGTGCTTTAGG - Intronic
948538499 2:238666952-238666974 GATTTGGGAAGAAAGGCTCTGGG + Intergenic
1170195591 20:13686102-13686124 GAATATGGATGAAGGGCATATGG + Intergenic
1172321970 20:34002338-34002360 GATTAGGGATGGAAGGCTGTTGG - Intronic
1172643704 20:36456960-36456982 GTTTATTGATCAAGTGCTCTGGG + Intronic
1172827272 20:37800151-37800173 GAAATTGGATGAAAGGCTCTGGG + Intronic
1175186977 20:57185305-57185327 GAAACTGGATGAAGGGCACTTGG - Intronic
1182320435 22:29475561-29475583 GATTATGGATGAATGATTCTTGG - Intergenic
1183855748 22:40633069-40633091 GGTTATGGATGAAGTGGTATAGG - Intronic
1184406984 22:44305856-44305878 AACTCTGGATGAAGGGGTCTGGG + Intronic
949753526 3:7382058-7382080 TATTATTGATGAATGGCTGTTGG - Intronic
953947345 3:47161225-47161247 GATAATGCATGAAGAGCACTTGG - Intronic
955448918 3:59046553-59046575 AATTATGGATGATGGATTCTGGG + Intronic
956681189 3:71783557-71783579 GGTTAAGGATGAAGGGCATTAGG - Intronic
961468131 3:127093680-127093702 GTTCATGGATGGAGGGCCCTGGG + Intergenic
963866061 3:150362969-150362991 GATTATGAATGAAAGGTTTTGGG - Intergenic
963962980 3:151330951-151330973 GATTATGGATTTGGGGCTATAGG - Intronic
967169819 3:186814242-186814264 GATCAGGGATGAAGGTGTCTGGG + Intergenic
968065771 3:195758242-195758264 GATCATGGATGTAGGGCTCGGGG + Intronic
977135869 4:93303358-93303380 GAATATAAATGAATGGCTCTGGG - Intronic
977712161 4:100138787-100138809 GATTATGAAGGAGGGCCTCTGGG - Intergenic
986905113 5:12486653-12486675 AAGTATGGATGATGGGCACTGGG - Intergenic
988332014 5:29853865-29853887 GACTGTAGATGAAGGGCTCCTGG - Intergenic
990080028 5:51901195-51901217 GATTATGAATGAAGATGTCTAGG + Intergenic
995716102 5:115083141-115083163 GGTTCTGGATGAGGGGCACTAGG + Intergenic
997249556 5:132377961-132377983 GGTTCTGGAAGCAGGGCTCTGGG - Intronic
997411844 5:133696707-133696729 GATTAGGCAAGAAGGGCTGTGGG + Intergenic
1001229792 5:169976466-169976488 GATGATGAATGTAGGGCCCTGGG + Intronic
1002565964 5:180113135-180113157 GAGGATGGATGGAGGGATCTGGG + Intronic
1003886789 6:10528904-10528926 GGTTGTGAATGATGGGCTCTTGG + Exonic
1006687866 6:35852677-35852699 GATGATGGAGAAAGAGCTCTTGG + Intronic
1007173672 6:39882119-39882141 GACTAGAGATGATGGGCTCTTGG + Intronic
1012970884 6:105729168-105729190 GATTATGTATGCAGAGCCCTTGG + Intergenic
1014192096 6:118507859-118507881 GTTTATGTATGAAGTGCTGTGGG - Intronic
1014268203 6:119306026-119306048 GATAATGCATGAATGGCACTTGG + Intronic
1014787464 6:125634928-125634950 GATTATGGACAAGGGGGTCTGGG - Intergenic
1017111702 6:150938825-150938847 GATTATGGATGAGGGTCTGTGGG - Intronic
1017497331 6:154994154-154994176 AATTTTGGCTGAAGGGCTCACGG + Intronic
1019665380 7:2249630-2249652 GATTTTGGTTGAGAGGCTCTGGG - Intronic
1020452231 7:8333150-8333172 GAAAATGGCTGAAGGCCTCTGGG + Intergenic
1021219770 7:17962557-17962579 GATTATCGATAATGGGCACTTGG - Intergenic
1022233932 7:28443282-28443304 CATTATGGCTGAAGAACTCTGGG + Intronic
1027990585 7:85355277-85355299 GACTTTGGCTGAAGGACTCTCGG - Intergenic
1029189834 7:98763880-98763902 GAAAATGTAGGAAGGGCTCTTGG + Intergenic
1029353307 7:100030942-100030964 GATTTTCTATGAAGAGCTCTGGG + Intronic
1031115481 7:117663259-117663281 GAATATGAATAAAGGGCACTGGG - Intronic
1032685213 7:134225710-134225732 GATTATGAATTCAGTGCTCTTGG + Intronic
1038669195 8:29568529-29568551 GTTTCTGGATGAAGGGCACATGG + Intergenic
1040585561 8:48737241-48737263 GAACATGGCTGATGGGCTCTAGG - Intergenic
1041535820 8:58924548-58924570 AATCATGCCTGAAGGGCTCTTGG - Intronic
1042374820 8:68038406-68038428 ACTGATGGATGATGGGCTCTGGG - Intronic
1044111517 8:88281318-88281340 GATCATGGATGATGAGCTCAAGG + Intronic
1046799811 8:118413512-118413534 CATTGTGGATGCAGTGCTCTAGG - Intronic
1053197154 9:36128106-36128128 CATTTTGGAGAAAGGGCTCTCGG + Intergenic
1054650658 9:67621340-67621362 GATTATGGAGGGAGTGCTCCTGG - Intergenic
1054810727 9:69431697-69431719 GAAAATGGAGGAAGGGCTCCAGG + Intronic
1057503393 9:95613573-95613595 GAAAATGAATGAAGGGCTATGGG + Intergenic
1057739581 9:97699850-97699872 GGTTATAGATGCAGGGCTTTGGG + Intergenic
1057809857 9:98249428-98249450 GATTGTGGAAGAACGGCTCTGGG - Intronic
1059842511 9:118233750-118233772 GATTATGGATCATGTGCTTTAGG + Intergenic
1061255772 9:129453678-129453700 GATGAGGGATGAAGGGATCAGGG + Intergenic
1061547093 9:131310760-131310782 GCTGAAGGATGGAGGGCTCTGGG + Intergenic
1186035391 X:5416662-5416684 GGTGAGGAATGAAGGGCTCTTGG - Intergenic
1187616799 X:21004113-21004135 TATTTTGGATGAAGCACTCTTGG - Intergenic
1189436794 X:41000036-41000058 GATTATAGATGAAGTGCTAGAGG + Intergenic
1189642630 X:43089211-43089233 GATAATGGATGAAAAGCTCTCGG + Intergenic
1190641009 X:52482732-52482754 GAGTAGGGATGGAGGGTTCTGGG - Intergenic
1190646663 X:52530133-52530155 GAGTAGGGATGGAGGGTTCTGGG + Intergenic
1191868763 X:65727558-65727580 GATGATGGATGTAAGGTTCTTGG + Intronic
1192677549 X:73214408-73214430 GATAATGGTGGAAGGGCTCGGGG - Exonic
1192901524 X:75503501-75503523 GATTATGTATGTAAGTCTCTTGG - Intronic