ID: 1077225386

View in Genome Browser
Species Human (GRCh38)
Location 11:1437148-1437170
Sequence AGTCCCATGCTGAATTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077225383_1077225386 1 Left 1077225383 11:1437124-1437146 CCAGTGCGGGGCGTAGCTGGGGA 0: 1
1: 0
2: 1
3: 11
4: 123
Right 1077225386 11:1437148-1437170 AGTCCCATGCTGAATTTGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 285
1077225375_1077225386 26 Left 1077225375 11:1437099-1437121 CCAGGACAGCGCCTGGCAGAGAG 0: 1
1: 0
2: 10
3: 109
4: 665
Right 1077225386 11:1437148-1437170 AGTCCCATGCTGAATTTGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 285
1077225376_1077225386 15 Left 1077225376 11:1437110-1437132 CCTGGCAGAGAGATCCAGTGCGG 0: 1
1: 0
2: 0
3: 14
4: 123
Right 1077225386 11:1437148-1437170 AGTCCCATGCTGAATTTGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077225386 Original CRISPR AGTCCCATGCTGAATTTGGG AGG Intronic
904597903 1:31658321-31658343 AGGATCATGCTGAATTTGGAAGG - Intronic
906578527 1:46913836-46913858 AGACCCATTCTCAATCTGGGTGG - Intergenic
907409214 1:54273018-54273040 AGTCCCATCCTGCACTTGGGAGG + Intronic
909131195 1:71739131-71739153 AGACCCATCCTTAATCTGGGTGG + Intronic
910497379 1:87846874-87846896 AGTCCCACCCTCAATTTGGTTGG + Intergenic
911263074 1:95710314-95710336 AGACCCACCCTCAATTTGGGTGG - Intergenic
912733774 1:112132462-112132484 AGACCCACCCTTAATTTGGGGGG - Intergenic
918354339 1:183692524-183692546 AGTCCCAGGTTGACTTTGGCTGG + Intronic
918555503 1:185794669-185794691 AGACCCATACTTAATCTGGGTGG - Intronic
918755004 1:188329149-188329171 ATTCCACCGCTGAATTTGGGTGG + Intergenic
918895435 1:190337421-190337443 AGACCCACCCTCAATTTGGGTGG + Intronic
919358846 1:196563971-196563993 AGTACTATGCTGAATTTAAGTGG - Intronic
922230231 1:223679435-223679457 ATTCACCTGCTGATTTTGGGAGG - Intergenic
922552541 1:226506738-226506760 AGACCCATCCTTAATCTGGGTGG - Intergenic
923516444 1:234701829-234701851 AAACCCATGCTGAAGTGGGGTGG + Intergenic
1066973304 10:42338530-42338552 AGTGCCATGCTGCATTATGGAGG - Intergenic
1068091816 10:52441206-52441228 CATCCCATGCTGAAGTTGAGGGG - Intergenic
1068288521 10:54971184-54971206 AGTCTCAACATGAATTTGGGAGG - Intronic
1068399496 10:56509608-56509630 AGACCCACCCTTAATTTGGGTGG + Intergenic
1068593752 10:58878842-58878864 AGTACCATGCTGAATAGGAGTGG + Intergenic
1069108348 10:64411117-64411139 AGACCCATCCTCAATGTGGGTGG - Intergenic
1069191989 10:65503863-65503885 AGACCCACCCTTAATTTGGGTGG - Intergenic
1069790506 10:71017085-71017107 AGTCCCACCCTTAATATGGGTGG - Intergenic
1070810614 10:79296018-79296040 ATTCCAAGGCTGAACTTGGGTGG - Intronic
1071497665 10:86179920-86179942 AATCCCATGCTGCACATGGGCGG + Intronic
1071670290 10:87602828-87602850 AGACCCAACCTTAATTTGGGTGG + Intergenic
1071804736 10:89105644-89105666 AGACCCACGCTCAATCTGGGTGG - Intergenic
1072224075 10:93351684-93351706 AGTTCCATGATAACTTTGGGTGG + Exonic
1074243883 10:111668474-111668496 AGACCCATCCTTAATCTGGGTGG - Intergenic
1074244475 10:111675190-111675212 AGACCCATCCTCAATCTGGGTGG + Intergenic
1074275098 10:111993469-111993491 AATCCCAAACTGAATTTGGTGGG - Intergenic
1074865088 10:117540226-117540248 AGTCTCAGGCTGAGTTTGGAGGG + Intergenic
1075814478 10:125254287-125254309 AGACCCACCCTCAATTTGGGTGG - Intergenic
1077225386 11:1437148-1437170 AGTCCCATGCTGAATTTGGGAGG + Intronic
1080098908 11:28436902-28436924 AGACCCATCCTCAATCTGGGTGG + Intergenic
1080145015 11:28971384-28971406 AGACCCATCCTTAACTTGGGTGG + Intergenic
1080251871 11:30242775-30242797 AGACCCACCCTCAATTTGGGTGG + Intergenic
1081065895 11:38538456-38538478 AGACCCATCCTTAATGTGGGTGG - Intergenic
1081221992 11:40473565-40473587 AGTACCATGTTGAATTAGAGTGG - Intronic
1081299521 11:41433538-41433560 AGACCCACCCTGAATCTGGGTGG + Intronic
1083569607 11:63751121-63751143 AATCCCATGCATGATTTGGGAGG - Intronic
1086049232 11:82569139-82569161 AGACCCACCCTTAATTTGGGTGG - Intergenic
1086057190 11:82660678-82660700 AGACCCACTCTTAATTTGGGTGG - Intergenic
1086788861 11:91008928-91008950 AGTACCATGCTGAATAGGAGTGG - Intergenic
1086989587 11:93288337-93288359 AGCCCCATGCCAGATTTGGGAGG + Intergenic
1087313840 11:96582804-96582826 AGTCCCATGTTGAATAGGAGTGG - Intergenic
1088286257 11:108191575-108191597 AAACCCATGCTGAAGTTAGGTGG + Intronic
1088913899 11:114212469-114212491 AGTCCCTTTCTAAATTTGTGTGG - Intronic
1089507627 11:118974453-118974475 ACTCCTCTGCTCAATTTGGGAGG - Intronic
1092819956 12:12344363-12344385 AGACCCACCCTGAATCTGGGTGG + Intronic
1094365464 12:29675111-29675133 AGTACCATGCTGAATCTGCAAGG - Intronic
1095141021 12:38662118-38662140 AGTGCCATGTTGAATAAGGGTGG - Intronic
1095298350 12:40552971-40552993 AGTACCATGGTGAATATGAGTGG + Intronic
1095400562 12:41809966-41809988 AGTACTATGTTGAATATGGGTGG + Intergenic
1095502986 12:42860800-42860822 AGACCCATCTTGAATCTGGGTGG - Intergenic
1095987426 12:48008782-48008804 AGTCCTAAGCTGAATTTGTATGG - Intergenic
1096402757 12:51320991-51321013 AGTCCCATGTTGAGTTTGGGCGG + Intronic
1096458016 12:51803372-51803394 AGACCCATCCTCAATGTGGGTGG - Intronic
1096711607 12:53461154-53461176 AGGCTCATGCTGAAAATGGGGGG + Intronic
1097448000 12:59697519-59697541 AGTCCTTTTCTGAATTTGGATGG + Intronic
1097628535 12:62031218-62031240 AGACCCATCCTTAATCTGGGTGG + Intronic
1098114047 12:67155759-67155781 AGTCCCATGTTCACTTTGAGGGG + Intergenic
1098672666 12:73250970-73250992 AGACCCATCCTTAATCTGGGTGG + Intergenic
1099184198 12:79499865-79499887 AGACCCATCCTTAATCTGGGTGG - Intergenic
1099401580 12:82208395-82208417 AGACCCATCCTCAATCTGGGTGG - Intergenic
1099423906 12:82499709-82499731 AGACCCACGCTCAATGTGGGTGG + Intergenic
1099697783 12:86043554-86043576 AGACCCATTCTCAATCTGGGTGG - Intronic
1100855746 12:98755957-98755979 AGCAACATGCTGAATTTGTGAGG + Intronic
1101036079 12:100707923-100707945 AGTCCAATGCTGAATATTGTAGG + Intergenic
1102421798 12:112809148-112809170 AGTCCCATCCTTAGTTTGGGAGG - Intronic
1103159275 12:118714129-118714151 AATGTCATGCTGAGTTTGGGCGG + Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104192927 12:126500729-126500751 AGTACCATGTTGAATTGGGGTGG - Intergenic
1105228921 13:18470258-18470280 AGTGCCATGCTGCATTATGGAGG - Intergenic
1105511479 13:21055484-21055506 AATCCCATGCTTAATATAGGTGG + Intronic
1106807900 13:33330138-33330160 TGTTCCATTCTGAATTTTGGGGG + Intronic
1106862921 13:33930527-33930549 AGACCCATCCTCAATCTGGGTGG - Intronic
1107229997 13:38097305-38097327 AGACCCATCCTTAATCTGGGTGG + Intergenic
1108968331 13:56340396-56340418 AGTACCATGCTGAATAGGAGTGG - Intergenic
1109057273 13:57566841-57566863 TGTGCCATTCTGATTTTGGGAGG + Intergenic
1111725651 13:92004991-92005013 AGACCCACCCTCAATTTGGGTGG - Intronic
1112231884 13:97596110-97596132 AGACCCATCCTTAATCTGGGTGG - Intergenic
1114013207 14:18397234-18397256 AGTGCCATGCTGCATTATGGAGG - Intergenic
1115060014 14:29176361-29176383 AGACCCACCCTTAATTTGGGTGG + Intergenic
1115785972 14:36826532-36826554 AGTCCACTGCTGATTTTGAGTGG - Intronic
1117597209 14:57335415-57335437 AGGCCCACCCTTAATTTGGGTGG - Intergenic
1117634443 14:57726853-57726875 AGGCCCACCCTTAATTTGGGTGG + Intronic
1117645545 14:57848239-57848261 AGTCAAATGCTGAATGAGGGTGG - Intronic
1117874415 14:60237336-60237358 AGACCCATCCTTAATCTGGGTGG + Intergenic
1117954963 14:61115691-61115713 AGTCCCAGGGAGATTTTGGGTGG + Intergenic
1118346387 14:64944235-64944257 TGTCCCCTGCTGAAGCTGGGTGG + Intronic
1119146363 14:72318344-72318366 AGACCCATCCTTAATCTGGGTGG - Intronic
1120356287 14:83438658-83438680 AGACCCACCCTCAATTTGGGTGG + Intergenic
1121606987 14:95247736-95247758 AGTCCCATTCTGAATTTCCAAGG - Intronic
1121742588 14:96264522-96264544 AGTCCGAGGCTGCTTTTGGGAGG + Exonic
1131446011 15:92498752-92498774 GGCCCCATGCTGTATTTGAGGGG - Intronic
1133643102 16:7736889-7736911 AGACCCATCCTCAATTTGGGTGG - Intergenic
1135564987 16:23505180-23505202 ATTCCCATGCTGAGTCTTGGAGG - Intronic
1138665414 16:58562877-58562899 AGTAACATTCTGAATTTAGGTGG - Intronic
1139292818 16:65873674-65873696 AGACCCACCCTCAATTTGGGTGG - Intergenic
1140688662 16:77459417-77459439 AATGCAATGCTAAATTTGGGTGG + Intergenic
1140988275 16:80181004-80181026 AGTACAATGCTGAATTTAAGTGG - Intergenic
1142575821 17:906823-906845 AATCCCAGCCTGACTTTGGGAGG - Intronic
1144000138 17:11046265-11046287 AGACCCACCCTCAATTTGGGTGG - Intergenic
1144319486 17:14100321-14100343 AGTTCACTGCTGTATTTGGGGGG - Intronic
1145976324 17:28986297-28986319 AGTCCCAGGCTGGGGTTGGGAGG - Intronic
1149641571 17:58206238-58206260 AGGCCCATGCTGACCTGGGGTGG + Intronic
1150964787 17:69955824-69955846 AGACCCATCCTCAATCTGGGTGG - Intergenic
1153319966 18:3763130-3763152 AGACCCACCCTTAATTTGGGTGG + Intronic
1154524531 18:15269867-15269889 AGTGCCATGCTGCATTATGGAGG + Intergenic
1155115958 18:22767367-22767389 AGTGCCATGCTGCCTTTGGAAGG + Intergenic
1156182112 18:34617149-34617171 AGTACTATGCTGAATATGTGTGG + Intronic
1156303432 18:35855155-35855177 AGACCCATCCTTAATCTGGGTGG + Intergenic
1157092070 18:44648475-44648497 AGTGCCATGCTGGAACTGGGTGG + Intergenic
1158162332 18:54499277-54499299 AGTCTCATCATGAATTTTGGTGG + Intergenic
1158896466 18:61918696-61918718 AGTCTGATGCTGACTCTGGGTGG - Intergenic
1159438278 18:68445968-68445990 AGACCCATCCTCAATCTGGGTGG + Intergenic
1162852594 19:13442154-13442176 GGTCCAATGGTTAATTTGGGAGG + Intronic
1167432441 19:49462220-49462242 ACTCCCAGGCTGAACCTGGGAGG - Intronic
925539201 2:4948567-4948589 AGACCCATCCTTAATATGGGTGG + Intergenic
926155578 2:10452100-10452122 AGCCCCATGAGGACTTTGGGAGG + Intergenic
926518021 2:13873987-13874009 AGTCCCACCCTTAATCTGGGTGG - Intergenic
927077585 2:19595508-19595530 AGACCCACCCTGAATCTGGGTGG + Intergenic
927104565 2:19812158-19812180 TCTCCCATGCTGTCTTTGGGAGG - Intergenic
927371818 2:22364605-22364627 AGTGCTATGCTGAATAGGGGTGG + Intergenic
927425147 2:22973283-22973305 AGACCCATCCTTAATCTGGGTGG + Intergenic
929032710 2:37663820-37663842 AGACCCATCCTCAATCTGGGTGG + Intronic
929991548 2:46793728-46793750 TGTCCCATGTTCACTTTGGGGGG + Intergenic
934125825 2:88889064-88889086 AGTACCATGCTGAATAAGAGTGG + Intergenic
938523717 2:132101981-132102003 AGTGCCATGCTGCATTATGGAGG + Intergenic
938645465 2:133325819-133325841 ACTCAAATGCTGAAGTTGGGAGG - Intronic
940550439 2:155148532-155148554 AGACCCACCCTTAATTTGGGTGG - Intergenic
940569816 2:155417049-155417071 AGTCCCCACCTGAAGTTGGGTGG + Intergenic
941392436 2:164930868-164930890 AGTACCATGTTGAATATGAGTGG - Intronic
941474087 2:165926692-165926714 AGACCCACCCTTAATTTGGGTGG + Intronic
943238970 2:185360515-185360537 AGACCCACTCTTAATTTGGGTGG - Intergenic
943383767 2:187178607-187178629 AGACCCATGCTTAATCTGGGTGG - Intergenic
943425115 2:187721884-187721906 AGTCCTATGCTGAATGGGAGTGG + Intergenic
945263912 2:207871280-207871302 AGTCCCATAATGGATTGGGGAGG - Intronic
946317945 2:218930695-218930717 AGTCCCACCCTGAATGTGGGTGG - Intergenic
948072380 2:235138348-235138370 AGTGCCGAGCTGGATTTGGGGGG + Intergenic
948995072 2:241573891-241573913 AGTGCCATGCTGCACTGGGGAGG - Exonic
1168897595 20:1334547-1334569 AGCCCTATGCTGGATTTGGGTGG + Intronic
1169267728 20:4176885-4176907 TGCCCTATGCTGAATTTGGAGGG + Intronic
1169488094 20:6050398-6050420 AGTCCCTTCCAGAATTTGAGTGG - Intronic
1170503856 20:17003720-17003742 AGGCCCACCCTCAATTTGGGTGG - Intergenic
1170586408 20:17737730-17737752 AGACCCACCCTTAATTTGGGTGG + Intergenic
1170745793 20:19097942-19097964 CATCCCATGCTTGATTTGGGGGG + Intergenic
1174666181 20:52260155-52260177 AGACCCACTCTCAATTTGGGTGG + Intergenic
1175719312 20:61275650-61275672 AGTACCATGCGCAGTTTGGGGGG + Intronic
1175930361 20:62490923-62490945 AGACCCATCCTTAATCTGGGTGG + Intergenic
1176772912 21:13098617-13098639 AGTGCCATGCTGCATTATGGAGG - Intergenic
1177139493 21:17342833-17342855 AGACCCACCCTTAATTTGGGTGG - Intergenic
1178011503 21:28291501-28291523 AGACCCACCCTCAATTTGGGTGG - Intergenic
1179930816 21:44569820-44569842 GGTCCCAGGCTGACTCTGGGAGG + Intronic
1180437705 22:15328046-15328068 AGTGCCATGCTGCATTATGGAGG - Intergenic
1180520554 22:16198336-16198358 AGTGCCATGCTGCATTATGGAGG - Intergenic
949093074 3:52422-52444 AGTGCCATGTTCTATTTGGGTGG - Intergenic
949659127 3:6256866-6256888 AGACCCACTCTCAATTTGGGTGG + Intergenic
950908359 3:16559882-16559904 AGACCCACCCTCAATTTGGGTGG + Intergenic
951868792 3:27336949-27336971 AGTACTATGTTGAATTTGAGTGG - Intronic
952242262 3:31544114-31544136 ATGCACATGATGAATTTGGGTGG + Intronic
953903040 3:46854032-46854054 AGTCCCATGCAGAATTCTGAAGG + Intergenic
954257681 3:49417829-49417851 AGTCCCATCCTGAACATGGAGGG - Exonic
954498897 3:50990852-50990874 AGACCCATCCTCAATTGGGGTGG - Intronic
955499053 3:59565985-59566007 AGACCCATGCTCAATCTGGGTGG + Intergenic
955811745 3:62798237-62798259 AGACCCATCCTTAATCTGGGTGG + Intronic
955820321 3:62889658-62889680 AGTGCCTTGCTGGATTTGGGGGG + Intergenic
955823608 3:62922203-62922225 AGACCCATGCTCAATCTGGATGG + Intergenic
957033337 3:75268515-75268537 AGTGCCATGTTCTATTTGGGTGG - Intergenic
958124366 3:89336643-89336665 AGTGACATGCTGTATTTGGGAGG - Intronic
959377896 3:105607428-105607450 AGACCCATCCTTAATGTGGGTGG - Intergenic
959746445 3:109780808-109780830 AGACCCATCCTTAATCTGGGTGG - Intergenic
961554033 3:127685437-127685459 AGTTCCAGGCAGAATTTGGTTGG + Intergenic
962146670 3:132846895-132846917 AGACCCACTCTTAATTTGGGTGG - Intergenic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
963460821 3:145612870-145612892 AGACCCATTCTCAATCTGGGTGG + Intergenic
963488791 3:145972540-145972562 AGACCCACCCTCAATTTGGGTGG + Intergenic
963570481 3:146988776-146988798 AGACCCACCCTCAATTTGGGTGG + Intergenic
963938222 3:151076065-151076087 ATCCCCATGATGAATTTGGTGGG - Intergenic
965226397 3:165997984-165998006 AGACCCATGCTTAATCTGGGCGG - Intergenic
965251935 3:166353339-166353361 AGACCCACCCTGAATCTGGGTGG - Intergenic
965299363 3:166990480-166990502 AGTCCCACCCTTAATCTGGGTGG - Intergenic
965707370 3:171522589-171522611 AGACCCACCCTCAATTTGGGTGG + Intergenic
967204403 3:187106528-187106550 AGACCCATCCTCAATCTGGGTGG + Intergenic
967516085 3:190370763-190370785 AGACCCACCCTTAATTTGGGTGG + Intronic
968430808 4:557309-557331 AGTCCCACCCTCAATCTGGGTGG + Intergenic
970477410 4:16437598-16437620 AGACCCATCCTCAATCTGGGTGG - Intergenic
971424412 4:26501957-26501979 AGACCCATGCTTAATCTAGGTGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
974223924 4:59014016-59014038 AGACCCATACTTAATCTGGGTGG + Intergenic
975098548 4:70485917-70485939 AGACCCATCCTCAATGTGGGTGG - Intergenic
975344137 4:73274899-73274921 AGTCACATGGTGAATATGTGAGG + Intergenic
975681249 4:76878779-76878801 AGACCCATCCTCAATCTGGGTGG + Intergenic
975974651 4:80081079-80081101 AGTCCCATTCTGAACTTGGAAGG - Intronic
976134914 4:81925278-81925300 AGTACAAGGCTGAATTTTGGAGG + Intronic
977627054 4:99198958-99198980 AGACCCACGCTTAATCTGGGTGG - Intergenic
979325814 4:119378241-119378263 AGACCTCAGCTGAATTTGGGAGG + Intergenic
981877440 4:149564555-149564577 AGACCCATCCTTAATCTGGGTGG + Intergenic
982139110 4:152300736-152300758 AGTCCCATGAGGAATGTAGGAGG - Intergenic
983243729 4:165263371-165263393 AGACCTCAGCTGAATTTGGGAGG + Intronic
983636230 4:169900376-169900398 AGACCCAAGCTGAACTTGGCAGG - Intergenic
983689532 4:170451517-170451539 AGACCCACCCTTAATTTGGGAGG + Intergenic
983824875 4:172247234-172247256 AGAGAGATGCTGAATTTGGGTGG - Intronic
983969157 4:173849747-173849769 AGACCCATCCTCAATCTGGGTGG - Intergenic
986625593 5:9720868-9720890 AGTGCCATGCTGCACTTGGAGGG + Intergenic
986645592 5:9913381-9913403 AGACCCACCCTGAATCTGGGTGG - Intergenic
987151653 5:15046764-15046786 AGACCCACCCTTAATTTGGGTGG + Intergenic
988785400 5:34562020-34562042 AGACCCACCCTTAATTTGGGTGG - Intergenic
989200965 5:38763387-38763409 AGACCCATCCTCAATCTGGGTGG + Intergenic
994369639 5:98953640-98953662 AGACCCATTCTTAATCTGGGTGG - Intergenic
994531177 5:100973849-100973871 AGACCCATCCTTAATTAGGGTGG + Intergenic
994604922 5:101954974-101954996 AGACCCATCCTTAATCTGGGTGG - Intergenic
994805126 5:104436758-104436780 AGACCCATCCTTAATCTGGGTGG + Intergenic
994855846 5:105118148-105118170 AGACCCATCCTCAATCTGGGTGG + Intergenic
997793250 5:136782108-136782130 AGACCCACCCTGAATCTGGGTGG - Intergenic
999308745 5:150537915-150537937 GGACCCATGCTGAATATCGGGGG + Intronic
1000445606 5:161314902-161314924 AGTCTCATACTAACTTTGGGGGG + Intronic
1001057423 5:168461208-168461230 AGTCCCAGGCTGTACTTGGGAGG + Intronic
1001768970 5:174278146-174278168 AGACCCAAGCTTAATCTGGGTGG + Intergenic
1003758143 6:9145611-9145633 AGTCCCATCCTTAATTGGGTGGG + Intergenic
1004853126 6:19721076-19721098 AGTACCATGCTGTATTTATGGGG - Intergenic
1005141828 6:22641223-22641245 AGACCCACACTTAATTTGGGTGG + Intergenic
1006193479 6:32223309-32223331 AGTCCGAGGCTGGACTTGGGAGG - Intronic
1006686483 6:35838983-35839005 AGTCCCATTCTGGATTTTGGAGG + Intronic
1008253444 6:49268669-49268691 AGTCATATGTTGAATTTGAGGGG - Intergenic
1010524258 6:76880982-76881004 AGTACCATGCTAAGTTTTGGGGG - Intergenic
1011296896 6:85835661-85835683 AGACCCATCCTTAATCTGGGTGG + Intergenic
1012442121 6:99270508-99270530 AATCCCAAGCTAAAGTTGGGAGG + Intergenic
1013126353 6:107188463-107188485 AGGCCCATTCTAAATCTGGGAGG - Intronic
1013823190 6:114180055-114180077 AGCCCCATCCTCAATGTGGGTGG - Intronic
1013908622 6:115247131-115247153 AGACCCATGCAGTACTTGGGGGG + Intergenic
1016697438 6:147014312-147014334 AGTCCCATGCTCAATATATGAGG - Intergenic
1017227444 6:152038293-152038315 AGACCCATCCTCAATCTGGGCGG - Intronic
1017228293 6:152044789-152044811 AGACCCATCCTCAATCTGGGTGG - Intronic
1018530216 6:164755110-164755132 AGACCCACTCTCAATTTGGGTGG + Intergenic
1023639729 7:42245421-42245443 AATCCCAGGCTTACTTTGGGAGG + Intergenic
1024366625 7:48528019-48528041 AGTGCCATGATGATTTTGAGAGG + Intronic
1027619883 7:80471249-80471271 AGACCCATCCTTAATCTGGGTGG - Intronic
1028253553 7:88564749-88564771 AGTCCCATCCTGAACTTGGAAGG + Intergenic
1028730658 7:94144531-94144553 AGTGACATCCTAAATTTGGGAGG - Intergenic
1030012784 7:105187747-105187769 AGTCTCATGGTGAATATGCGTGG + Intronic
1030037710 7:105422116-105422138 AGACCCATCCTCAATCTGGGTGG - Intergenic
1030360206 7:108587678-108587700 AGACCCATCCTCAATCTGGGTGG - Intergenic
1030810961 7:113971483-113971505 AGACCCATCCTCAATTTGGGTGG - Intronic
1032630266 7:133643380-133643402 AGACCCACCCTTAATTTGGGTGG - Intronic
1033065905 7:138153690-138153712 ATCCCCATGCAGCATTTGGGAGG - Intergenic
1033501116 7:141950735-141950757 AGACCCACCCTCAATTTGGGTGG + Intronic
1033810994 7:145010960-145010982 AGTCTCATTCTGAACATGGGAGG - Intergenic
1034123187 7:148645731-148645753 AGACCCATCCTCAATCTGGGTGG + Intergenic
1034490152 7:151388824-151388846 AGTTCCAGCATGAATTTGGGGGG - Intronic
1035877623 8:3208696-3208718 AGACCCACCCTTAATTTGGGTGG + Intronic
1037632846 8:20673793-20673815 AGACCCATCCTCAATGTGGGTGG - Intergenic
1038859541 8:31372182-31372204 AGTACTATGCTGAATATGGGTGG + Intergenic
1040961778 8:53041905-53041927 AGTCCTATGCTGAATAGGAGTGG + Intergenic
1043116947 8:76268513-76268535 AGACCCATCCTTAATCTGGGTGG + Intergenic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1044027475 8:87191384-87191406 AGACCCACCCTCAATTTGGGTGG - Intronic
1044082066 8:87897465-87897487 AGACCCATCCTCAATGTGGGTGG + Intergenic
1044337635 8:91006275-91006297 AGTCACATGCTAAACATGGGAGG - Intronic
1045128856 8:99125413-99125435 AGACCCATCCTCAATCTGGGTGG - Intronic
1045393699 8:101739512-101739534 AGACCCATCCTCAATCTGGGTGG + Intronic
1046126177 8:109911261-109911283 AGACCCATCCTTAATCTGGGTGG - Intergenic
1046417296 8:113934689-113934711 AGACCCATCCTTAATCTGGGTGG - Intergenic
1048318179 8:133377304-133377326 AGGCCCATGCAGAATGTGGCTGG + Intergenic
1048746959 8:137625044-137625066 AGACCCACCCTCAATTTGGGTGG - Intergenic
1051002240 9:12297671-12297693 AGACCCATCCTTAATTTGGGTGG + Intergenic
1051227609 9:14918333-14918355 AGACCCATCCTTAATCTGGGTGG - Intergenic
1052208942 9:25878305-25878327 AATCCCAGGCTCACTTTGGGAGG - Intergenic
1053702462 9:40709608-40709630 AGTGCCATGCTGCATTATGGAGG + Intergenic
1054412521 9:64833071-64833093 AGTGCCATGCTGCATTATGGAGG + Intergenic
1055376655 9:75655852-75655874 AGTTTCATCATGAATTTGGGAGG - Intergenic
1056539442 9:87558824-87558846 ATTCCCATGCTCCATGTGGGCGG + Intronic
1056966982 9:91171420-91171442 AGTACTATGTTGAATATGGGTGG - Intergenic
1058381300 9:104379788-104379810 AGACCCATGCTCAATCTGGGTGG + Intergenic
1058549897 9:106103541-106103563 AGACCCATCCTTAATCTGGGTGG + Intergenic
1058606315 9:106727359-106727381 AGACCCATCCTTAATCTGGGTGG - Intergenic
1058650304 9:107169591-107169613 AGTCCCATCCTGAACTTGGAAGG + Intergenic
1058766908 9:108190615-108190637 AGAGCCATGATGTATTTGGGAGG + Intergenic
1059552914 9:115248018-115248040 AGACCCATCCTTAATCTGGGTGG + Intronic
1059881709 9:118697516-118697538 AGACCCATCCTCAATCTGGGTGG - Intergenic
1186087538 X:6006630-6006652 AGTCCCATGCTGAAGAGAGGTGG - Intronic
1188230490 X:27656988-27657010 AGACCCACCCTTAATTTGGGTGG + Intronic
1188707589 X:33355187-33355209 AGACCCATCCTCAATCTGGGTGG + Intergenic
1189785724 X:44557233-44557255 AGACCCATCCTCAATGTGGGTGG - Intergenic
1191096750 X:56681154-56681176 AGACACATCCTGAATCTGGGTGG - Intergenic
1191660218 X:63641819-63641841 AGACCCATGCTCAATCTGGATGG + Intronic
1192149275 X:68701905-68701927 TGTCCCATGCTAGAATTGGGTGG + Intronic
1192728828 X:73781626-73781648 AGACCCACCCTCAATTTGGGTGG - Intergenic
1192891325 X:75394011-75394033 AGACTCATTCTTAATTTGGGTGG - Intronic
1193262520 X:79425330-79425352 AGACCCACACTTAATTTGGGTGG - Intergenic
1193484305 X:82067517-82067539 AGACCCATGCTCAATCTGGGTGG - Intergenic
1193551795 X:82902613-82902635 AGTACCATGTTGAATTGGAGTGG - Intergenic
1193568536 X:83111405-83111427 AGACCCACCCTCAATTTGGGTGG - Intergenic
1193944241 X:87712456-87712478 AGTACAATGTTGAATATGGGTGG - Intergenic
1194130078 X:90070748-90070770 AGACCCATCCTGAATCTGGGTGG + Intergenic
1194161422 X:90457591-90457613 AGACCCACCCTCAATTTGGGTGG - Intergenic
1194275758 X:91879080-91879102 AGTTTCAGGCTGAATTTGGAAGG - Exonic
1194477798 X:94380240-94380262 AGACCCATCCTCAATCTGGGTGG - Intergenic
1195430523 X:104784121-104784143 AATTTCATGCTGAAATTGGGTGG + Intronic
1195474585 X:105271438-105271460 ATTCTCATGTTGAATTTGTGCGG + Intronic
1195707090 X:107745097-107745119 ACTCACATGCTGGCTTTGGGTGG - Intronic
1195997209 X:110743288-110743310 TGACCAATGCTGACTTTGGGTGG + Intronic
1196139895 X:112249523-112249545 AGGCCCATGCTGATTTGGGAGGG - Intergenic
1196372366 X:114994114-114994136 AGACCCACCCTTAATTTGGGTGG - Intergenic
1198109054 X:133486805-133486827 AGACCCATCCTTAATGTGGGTGG - Intergenic
1199152020 X:144498390-144498412 AGACCCACGCTCAATCTGGGTGG + Intergenic
1199163941 X:144648057-144648079 AGACCCATCCTTAATCTGGGTGG - Intergenic
1200593002 Y:5100514-5100536 AGTTTCAGGCTGAATTTGGAAGG - Exonic
1202015982 Y:20407110-20407132 TGTCCCATGCCCTATTTGGGGGG - Intergenic