ID: 1077226400

View in Genome Browser
Species Human (GRCh38)
Location 11:1440713-1440735
Sequence CTGTGGGAGGCCCTGGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4146
Summary {0: 1, 1: 0, 2: 3, 3: 170, 4: 3972}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077226391_1077226400 5 Left 1077226391 11:1440685-1440707 CCTGCAGAGAGGCTGGGCCAGGA 0: 1
1: 0
2: 1
3: 76
4: 581
Right 1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG 0: 1
1: 0
2: 3
3: 170
4: 3972
1077226384_1077226400 30 Left 1077226384 11:1440660-1440682 CCAGCCAGCAAGAGGATGGGGGC 0: 1
1: 0
2: 4
3: 25
4: 212
Right 1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG 0: 1
1: 0
2: 3
3: 170
4: 3972
1077226386_1077226400 26 Left 1077226386 11:1440664-1440686 CCAGCAAGAGGATGGGGGCGGCC 0: 1
1: 0
2: 3
3: 9
4: 128
Right 1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG 0: 1
1: 0
2: 3
3: 170
4: 3972

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077226400 Original CRISPR CTGTGGGAGGCCCTGGGATG AGG Intronic
Too many off-targets to display for this crispr