ID: 1077226466

View in Genome Browser
Species Human (GRCh38)
Location 11:1440996-1441018
Sequence TGTAGTCCTTGGGGCACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 683
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 654}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077226466_1077226475 0 Left 1077226466 11:1440996-1441018 CCCCCTGTGCCCCAAGGACTACA 0: 1
1: 0
2: 0
3: 28
4: 654
Right 1077226475 11:1441019-1441041 CCCCCTATGGTGCTATTCCGAGG 0: 1
1: 0
2: 0
3: 4
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077226466 Original CRISPR TGTAGTCCTTGGGGCACAGG GGG (reversed) Intronic
900268305 1:1772282-1772304 TGTAGTCCCTGGTACTCAGGAGG - Intronic
900306028 1:2008701-2008723 TGTAGTCCCAGGGACCCAGGAGG + Intergenic
900671081 1:3855301-3855323 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
900852467 1:5154774-5154796 TGTAGTCCTAGGTACTCAGGAGG - Intergenic
901503428 1:9668490-9668512 AGTAGTTTTTGGGGTACAGGTGG + Intronic
902179172 1:14674906-14674928 TGTAGTCCCAGGTGCTCAGGAGG - Intronic
902899162 1:19502213-19502235 TGTAGTCCTAGGTACTCAGGAGG - Intergenic
902903852 1:19539561-19539583 TGTAGTCCTAGGTACTCAGGAGG + Intergenic
903240488 1:21979572-21979594 TGTAGTCCTAGCTACACAGGAGG - Intronic
903244230 1:22004191-22004213 TGTAGTCCTAGCTACACAGGAGG - Intronic
903299906 1:22371339-22371361 TGTAGTCCTAGGTACTCAGGAGG + Intergenic
903877400 1:26484787-26484809 TGTAATCCTTGGGCTTCAGGAGG - Intergenic
904141096 1:28353802-28353824 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
904192077 1:28753424-28753446 TGTAGTCCTAGTTGCTCAGGAGG + Intronic
904510159 1:30998520-30998542 TGTAGTCCTTGCTACTCAGGAGG + Intronic
904679552 1:32219512-32219534 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
904804190 1:33119417-33119439 TGGAGACCATGGGGCACATGAGG + Intronic
905180982 1:36166509-36166531 TGTAGTCCCAGGTACACAGGAGG - Intronic
906070794 1:43015060-43015082 AGTAGTTTTTGGGGTACAGGTGG - Intergenic
906233553 1:44187491-44187513 TGTAGTCCTAGACACACAGGAGG - Intergenic
906235081 1:44201729-44201751 TGTAGTCCTGGCTGCTCAGGAGG + Intergenic
906515638 1:46437363-46437385 TGTAAACCTAGGGGCACAAGGGG - Intergenic
906990812 1:50735836-50735858 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
907100845 1:51833728-51833750 TGTAGTCCTTGGCACTCAGGAGG - Intronic
908118234 1:60961845-60961867 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
908122197 1:60996758-60996780 TGTAGTCCTTGCTACTCAGGAGG + Intronic
908253883 1:62286759-62286781 TGTGGTCCTGGGGCCCCAGGAGG - Intronic
908772027 1:67606212-67606234 TGTAGTCCTAGCTGCTCAGGGGG - Intergenic
909332367 1:74428811-74428833 TGTAGTCCTTGCTACTCAGGAGG + Intronic
910355079 1:86344043-86344065 AATAGTTCTTGGGGAACAGGTGG + Intergenic
910691802 1:89973143-89973165 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
910733191 1:90421279-90421301 TCTAGTCCTTGGTGCCCAGATGG + Intergenic
910952341 1:92663867-92663889 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
912511411 1:110192584-110192606 TGTAGTCCTTTGTGGTCAGGTGG - Exonic
913132392 1:115853029-115853051 TGTAATCCTAGTGGCTCAGGAGG + Intergenic
914221787 1:145688144-145688166 AGTAATGCTGGGGGCACAGGAGG + Intronic
915768636 1:158394026-158394048 AGTAGTTTTTGGGGAACAGGTGG + Intergenic
915782247 1:158565156-158565178 TGTAGTCCTAGCTACACAGGAGG - Intergenic
916064474 1:161124837-161124859 TGTAGTCCCAGCTGCACAGGAGG + Intronic
916073590 1:161186877-161186899 TGTAGTCCTAGGTACTCAGGAGG + Exonic
916149114 1:161768683-161768705 TGTAGTCCTAGCGACTCAGGAGG - Intronic
916297835 1:163239362-163239384 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
916429552 1:164713825-164713847 TTTGGTCCTAGAGGCACAGGTGG - Intronic
916784178 1:168071943-168071965 TGAAGTCCTGGGGGCAAAGTTGG - Intronic
916836753 1:168553980-168554002 TGTATTCCGTGGGGTACATGTGG - Intergenic
916897237 1:169177956-169177978 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
916942847 1:169694384-169694406 AGATGTCCTTGAGGCACAGGAGG - Intronic
917103548 1:171469770-171469792 TGTGGTCCTGGCTGCACAGGAGG - Intergenic
917160705 1:172054307-172054329 TGTTGTCTCTGGGGCACTGGAGG + Intronic
917382619 1:174430258-174430280 TGTAGTCCCAGAGGCTCAGGTGG + Intronic
917490519 1:175494212-175494234 TGCAGTTCTATGGGCACAGGTGG + Intronic
917918869 1:179732757-179732779 TGTAGTCCCAGCTGCACAGGAGG + Intergenic
917946308 1:179974867-179974889 TGTAGTCCTAGCAACACAGGAGG + Intronic
918549895 1:185730286-185730308 TGTATGACTTGGGACACAGGAGG - Intergenic
919361071 1:196595705-196595727 AATAGTTTTTGGGGCACAGGTGG + Intronic
920199958 1:204253710-204253732 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
920354668 1:205361970-205361992 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
921061115 1:211585216-211585238 TGTAGTAGTTGGTGCACATGAGG - Intergenic
922026495 1:221754655-221754677 TGTAGTCCTAGCTACACAGGAGG + Intergenic
923446083 1:234072712-234072734 TGAAGTGTTTGGGGAACAGGAGG + Intronic
923460821 1:234207885-234207907 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
923815340 1:237371275-237371297 TGTAGTCCTAGCTACACAGGAGG - Intronic
924074292 1:240317192-240317214 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
924246997 1:242095056-242095078 TGTAGTCCCAGGTACACAGGAGG - Intronic
924675565 1:246173926-246173948 TGTAGTCCTGGGTACTCAGGAGG - Intronic
924691260 1:246353406-246353428 TGTAGTCCCAGTGGCTCAGGAGG + Intronic
924725433 1:246665249-246665271 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1063425868 10:5949586-5949608 AGAAGTCCTTGGGGAACAGGGGG + Intronic
1064272639 10:13879389-13879411 TGTAGTCCCTGGTACTCAGGAGG + Intronic
1064453061 10:15461058-15461080 TGTAGTCCTGGCTGCTCAGGAGG - Intergenic
1064531505 10:16315114-16315136 TGTAGTCCTTGCTACTCAGGAGG - Intergenic
1065016204 10:21464964-21464986 TGTAATCCCAGGTGCACAGGAGG + Intergenic
1065317936 10:24482896-24482918 TGTAGCCCTAGGTGCTCAGGAGG + Intronic
1065392220 10:25194415-25194437 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1065691282 10:28336386-28336408 TGTAGTCCTGGGTACTCAGGAGG + Intergenic
1065731284 10:28711934-28711956 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
1066117527 10:32253752-32253774 TGCAGTATTTGGGGCACAGGAGG + Intergenic
1066128217 10:32363193-32363215 TGTAGTCCCAGGTGCTCAGGAGG - Intronic
1066151087 10:32619712-32619734 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1067120611 10:43469316-43469338 TGTAGTCCCAGGTGCTCAGGAGG - Intronic
1067776567 10:49168612-49168634 TGCAGTGCTTGGCCCACAGGAGG + Intronic
1069092865 10:64223370-64223392 TGCAGTCCTTGGGGTAGATGTGG - Intergenic
1069914894 10:71781435-71781457 GGGAGTCCCTGGAGCACAGGAGG + Intronic
1069955607 10:72049365-72049387 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1070193879 10:74138807-74138829 TGTAGTCCTAGGTACTCAGGAGG + Intronic
1070239621 10:74665611-74665633 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1070959287 10:80487654-80487676 TAGAGTCCTTGGGCAACAGGTGG + Intronic
1071041726 10:81317435-81317457 TGTAGTTTTTGGGGTACAGGAGG + Intergenic
1071365768 10:84899328-84899350 TGCAGTACTTGGCACACAGGAGG + Intergenic
1072099783 10:92217986-92218008 TGTAGTCCTAGCTACACAGGAGG + Intronic
1072164836 10:92803304-92803326 TGTAGTCCTAGCTGCTCAGGGGG - Intergenic
1072254072 10:93603830-93603852 TTTAGTACTTGTAGCACAGGTGG + Intronic
1072644082 10:97238339-97238361 TGTAGTCCTAGCTACACAGGAGG - Intronic
1072931269 10:99665128-99665150 TGTAGTCCTTGCTTCCCAGGAGG + Intronic
1073234996 10:102006815-102006837 TGTAGTCCTACGTACACAGGAGG - Intronic
1074835178 10:117284946-117284968 TGTGGTCGTGGTGGCACAGGTGG + Exonic
1076488738 10:130841532-130841554 AGTAGTTTTTGGGGAACAGGTGG - Intergenic
1077226466 11:1440996-1441018 TGTAGTCCTTGGGGCACAGGGGG - Intronic
1077620289 11:3715737-3715759 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1077884105 11:6373223-6373245 TGTAGTCCTAGCTACACAGGAGG + Intergenic
1078234886 11:9475379-9475401 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1079047661 11:17121237-17121259 TGTAGTCCTAGCGACTCAGGAGG - Intronic
1079205249 11:18409258-18409280 TGTAGTCCTAGCTGCACAGGAGG + Intergenic
1079453577 11:20618407-20618429 TTTAGTGCTAGGGGCACATGGGG - Intronic
1079482498 11:20896001-20896023 ACTAGTTTTTGGGGCACAGGTGG + Intronic
1080987122 11:37482139-37482161 TGTAGTCCCAGGTGCTCAGGAGG + Intergenic
1081479205 11:43468801-43468823 TGTAGTCCTAGCTACACAGGAGG + Intronic
1081716599 11:45254992-45255014 TGTAGTCCTAGGTACTCAGGAGG + Intronic
1081919621 11:46761125-46761147 TGTAGTCCTTGCTACTCAGGAGG + Intronic
1083923202 11:65791408-65791430 TGTGGTCAGTGGGGCCCAGGAGG + Intronic
1084291882 11:68176661-68176683 TGTAGTCCTAGGTACTCAGGAGG + Intronic
1086676830 11:89618525-89618547 TGTAGACTTTGGGACACAGAGGG + Intergenic
1086950141 11:92883146-92883168 TGTAGGCCATGGGGCGCACGGGG - Exonic
1087258712 11:95986317-95986339 TGTAATCCCAGGGGCTCAGGAGG - Intronic
1087690510 11:101316355-101316377 TGTAGTCCTAGGTACTCAGGAGG + Intergenic
1087819651 11:102697621-102697643 TGTAGTCCCAGCTGCACAGGAGG - Intronic
1088496075 11:110432433-110432455 AGTAGTTTTGGGGGCACAGGTGG + Intronic
1088653791 11:111979830-111979852 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1089401901 11:118169141-118169163 TGTGGTCTTTGGGGCAAAGCGGG + Intronic
1089539024 11:119178790-119178812 TGTAGTCCCTTGAGCACTGGAGG - Intronic
1089644793 11:119871706-119871728 TGCTGACCTTGGGGCAAAGGGGG - Intergenic
1089770190 11:120797027-120797049 TGAAGTTCTTGGGGCTCATGGGG + Intronic
1089896445 11:121935067-121935089 TGTCTTCCTTGGGGCTTAGGGGG - Intergenic
1089979603 11:122761347-122761369 TGTAGTCCTAGCTACACAGGAGG + Intronic
1090387390 11:126364930-126364952 TGTTCTCTTTGGGGCACAGCTGG + Intronic
1090389956 11:126382128-126382150 TGTTCTCTTTGGGGCACAGCTGG + Intronic
1090449669 11:126795489-126795511 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1090688715 11:129154855-129154877 AGTAGTTTTTGGGGAACAGGTGG - Intronic
1091817268 12:3448116-3448138 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1091895052 12:4095675-4095697 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1093226342 12:16488413-16488435 TGAAGACTTTGGGGCACAAGAGG - Intronic
1094006806 12:25762305-25762327 TGTAGTCCTTGCTGCTCAGGGGG + Intergenic
1094125496 12:27018710-27018732 TGTAGTCCTAGATACACAGGTGG + Intergenic
1094591255 12:31823079-31823101 AATAGTTCTTGGGGAACAGGTGG + Intergenic
1095052159 12:37564114-37564136 TGTAGTCCCTGCTACACAGGAGG - Intergenic
1096261573 12:50095679-50095701 AGTAGTGCTGGGGGCATAGGAGG + Intronic
1096859231 12:54511526-54511548 TGTAGTCCTAGGTACTCAGGAGG - Intronic
1097461154 12:59863490-59863512 TGTAGTCCTAGCTACACAGGAGG - Intergenic
1097771854 12:63595733-63595755 TGTAGTCCTTGATACACAGTTGG + Intronic
1097778235 12:63672444-63672466 TGTAGTCCTTGCTACTCAGGAGG - Intergenic
1097852637 12:64427616-64427638 TGTAGTCCCAGGTGCTCAGGGGG - Intronic
1098334886 12:69393344-69393366 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1098883411 12:75939852-75939874 TGTAGTCCTTGCTACTCAGGAGG - Intergenic
1100298449 12:93284815-93284837 TGTAGTCCTAGCTACACAGGAGG - Intergenic
1100456460 12:94756352-94756374 TGTAGTCCTGGCTGCACAGGAGG + Intergenic
1100842151 12:98623378-98623400 TGTAGTCCTAGCGACGCAGGAGG - Intronic
1102366639 12:112342333-112342355 TGTAGTCCTACAGGCTCAGGAGG + Intronic
1102486131 12:113258657-113258679 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1103326283 12:120123220-120123242 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1103575032 12:121871241-121871263 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1104692411 12:130837232-130837254 TGTAGTCCTTGGTACTCAGGAGG - Intronic
1105065067 12:133189927-133189949 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1105831089 13:24163278-24163300 TGTAGTCCAAGGTGCTCAGGAGG + Intronic
1106285386 13:28314074-28314096 TGTAGTCCCTGTAGTACAGGAGG + Intronic
1106574930 13:30965950-30965972 TCTGGTCCCTGGGGCAGAGGTGG - Intronic
1106790107 13:33146360-33146382 TGTAGTCCTAGCTACACAGGAGG + Intronic
1108085997 13:46794453-46794475 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1109036411 13:57267301-57267323 TGTAGTCCTAGGTACTCAGGAGG + Intergenic
1110836095 13:80085107-80085129 TGTAGTCCTAGCTACACAGGAGG - Intergenic
1111184476 13:84713868-84713890 AGTAGTTTTTGGGGTACAGGTGG + Intergenic
1111863970 13:93744809-93744831 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1112525805 13:100145738-100145760 TGTAGTCCCTGCGACTCAGGAGG + Intronic
1112782518 13:102916642-102916664 TGTAGTCCTAGCGACTCAGGAGG - Intergenic
1114704140 14:24708446-24708468 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1115318034 14:32046826-32046848 AGAAGTCCTTGGTCCACAGGGGG + Intergenic
1115510158 14:34130717-34130739 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1116460663 14:45169519-45169541 TGTAGTCCTAGCCACACAGGAGG - Intronic
1116629559 14:47312623-47312645 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1117241007 14:53832643-53832665 AGTAGTTTTTGGGGAACAGGTGG - Intergenic
1117870685 14:60197674-60197696 TGTAGCCCTTGTGACACAGATGG - Intergenic
1118191466 14:63584498-63584520 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1118721124 14:68594550-68594572 TGTAGTCCTAGCTGCTCAGGAGG - Exonic
1118834655 14:69468700-69468722 TGTAGTCCTGGCTGCTCAGGAGG - Intergenic
1119226045 14:72945269-72945291 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1119311458 14:73650103-73650125 TGTAGTCCTAGGTACTCAGGAGG - Intronic
1119378074 14:74210933-74210955 TGTAGTCCCTGCTGCTCAGGAGG + Intergenic
1121048228 14:90803309-90803331 TGCAGTGCTTGGGCCATAGGAGG + Intronic
1121135644 14:91495795-91495817 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1121198988 14:92101734-92101756 TGTAGTCCCAGGTGCTCAGGAGG + Intronic
1121218794 14:92269525-92269547 AGTAGTTTTTGGGGAACAGGTGG + Intergenic
1122116519 14:99530313-99530335 TGTAGTCTTTGGGTCTCTGGAGG - Intronic
1122196375 14:100089809-100089831 TGTAGTCCTTGCTACTCAGGAGG + Intronic
1122378262 14:101283463-101283485 CCCAGTCCTTGGGGCACAGGAGG - Intergenic
1122474971 14:102001303-102001325 TGTACTGCTTGTGGCACAAGGGG + Exonic
1122682061 14:103472523-103472545 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1122982623 14:105198484-105198506 AGGAGTCCCAGGGGCACAGGTGG + Intergenic
1122988741 14:105226358-105226380 TGTGGTCCCTGGGGCCCACGCGG - Intronic
1123430593 15:20212305-20212327 TGTAGTCCTTGGAGCTGAGGTGG - Intergenic
1123903220 15:24897029-24897051 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1124418862 15:29499501-29499523 TGTAGTCCTAGGTACCCAGGAGG - Intronic
1124422508 15:29535126-29535148 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1124724974 15:32148606-32148628 GGGAGCCCATGGGGCACAGGTGG - Intronic
1125666355 15:41433454-41433476 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1125979804 15:43989837-43989859 GGTTGGCCTTGGGGCTCAGGGGG + Intronic
1126000316 15:44203428-44203450 TGTAGTCCTTGCTACTCAGGAGG - Intergenic
1126981538 15:54249805-54249827 AGTATTCCTTGGGGCTGAGGAGG + Intronic
1127097565 15:55527711-55527733 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1127355013 15:58189661-58189683 TCTAGGCCCTGGGGCAGAGGTGG - Intronic
1128013691 15:64323042-64323064 TGTAGTCCTAGGTACTCAGGGGG - Intronic
1128045634 15:64615262-64615284 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1128160288 15:65419176-65419198 TGTTGTCCTTGCTGCTCAGGAGG - Intronic
1128194304 15:65737182-65737204 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1128470172 15:67945046-67945068 TGTAGTCCTAGGTACTCAGGAGG + Intergenic
1128595253 15:68940134-68940156 AGTAGTTTTTGGGGAACAGGTGG + Intronic
1129210010 15:74062986-74063008 TGTAGCACTGGGGACACAGGTGG + Intergenic
1129284292 15:74511729-74511751 TGTAGTCCTTGTTACTCAGGAGG - Intergenic
1129422312 15:75438565-75438587 TGTAGTCCTTGCTGCTTAGGAGG + Intronic
1129477022 15:75792445-75792467 TGTAGCACTGGGGACACAGGTGG - Intergenic
1130685102 15:86030449-86030471 TGTAGTCCTAGCTACACAGGAGG - Intergenic
1131142160 15:89985951-89985973 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
1131293922 15:91130711-91130733 TGCAGTCCTGGGGGCAAAGAGGG + Intronic
1131311116 15:91290890-91290912 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1131848071 15:96509273-96509295 TGTAGTCCTGGCTGCTCAGGAGG + Intergenic
1132249740 15:100326453-100326475 AGTTATCCCTGGGGCACAGGTGG + Intronic
1132405166 15:101537416-101537438 TGCTGTGTTTGGGGCACAGGTGG - Intergenic
1132575110 16:660547-660569 TGCAGGCTTTGGGGCACAGGTGG + Intronic
1132641250 16:979597-979619 TCAAGTCCCTGGGACACAGGTGG - Intronic
1133528893 16:6633887-6633909 TGTAGTCCTAGCGACTCAGGAGG + Intronic
1133845753 16:9452226-9452248 AGTAGTTTTTGGGGAACAGGTGG + Intergenic
1134804034 16:17109581-17109603 TGCAGTCCTTGGGCCAAATGTGG + Intronic
1135021996 16:18970596-18970618 TGTAGTCCCAGGTGCTCAGGAGG - Intergenic
1135233402 16:20730979-20731001 TGTAGTCCTAGCGACTCAGGAGG - Intronic
1135709984 16:24708202-24708224 AGTAGTTTTTGGGGTACAGGTGG + Intergenic
1136854044 16:33638912-33638934 TGTAGTCCTTGGAGCTGAGGTGG + Intergenic
1138011622 16:53386211-53386233 TGTAGTCCTGGCTGCTCAGGAGG - Intergenic
1139488177 16:67271120-67271142 TGTGGTCCTTGTGGCCCATGAGG - Exonic
1139533137 16:67553597-67553619 TGTAGTCCTAGCGACTCAGGAGG + Intergenic
1139670407 16:68489247-68489269 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1139779366 16:69338196-69338218 TGTAGTCCCAGGTACACAGGAGG - Intronic
1139916073 16:70429221-70429243 GGTAGTACTGGGGGCCCAGGAGG - Intronic
1139942090 16:70612699-70612721 TGGAGCCTTTGGGGCTCAGGAGG + Intronic
1140397388 16:74640089-74640111 TGTATTCCTTGTGGCTAAGGGGG + Intronic
1140510155 16:75501536-75501558 TGTAGTCCTAGCGGCCCAGGAGG + Intergenic
1141087496 16:81107254-81107276 TGTAGTCCTAGCTACACAGGAGG - Intergenic
1141578732 16:84982780-84982802 TCTAGCACTTGGGGCACAGATGG - Intronic
1142310517 16:89309849-89309871 GGTGGTCCTTGGGGCATAGTGGG - Intronic
1142986699 17:3699427-3699449 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1143172028 17:4935870-4935892 TGCAGTACTAGGGGCAAAGGTGG + Intergenic
1143516537 17:7421936-7421958 TGTAGTCCTAGTGACTCAGGAGG - Intergenic
1143837269 17:9702245-9702267 TGTAGTCCTAGTTGCTCAGGAGG + Intronic
1144060109 17:11575549-11575571 TGTTTTCCATGGGGCACAAGAGG + Intergenic
1144308184 17:13988381-13988403 TGTAGTCCTAGTGACTCAGGAGG + Intergenic
1144688348 17:17242106-17242128 TGTTGACCTTGGGGTTCAGGGGG - Intergenic
1144952226 17:19000481-19000503 TCTAGTCATTTGGGAACAGGGGG + Intronic
1145372658 17:22320037-22320059 TGTAGTCCCTGCTACACAGGAGG - Intergenic
1145885458 17:28379430-28379452 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1145954638 17:28846079-28846101 TGTAGTCCCAGGTACACAGGAGG + Intronic
1146128713 17:30251208-30251230 AGTAGTTTTTGGGGAACAGGTGG - Intronic
1147162318 17:38575369-38575391 TGTAGTCCTTGCTACTCAGGAGG - Intronic
1147272715 17:39287526-39287548 TGTAGTCCTTGCTACTCAGGAGG - Intronic
1147282977 17:39377889-39377911 TGTAGTCCTAGCTACACAGGAGG + Intronic
1147783323 17:42959783-42959805 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1148119293 17:45198139-45198161 GGTAGTGTTAGGGGCACAGGTGG - Intergenic
1148173133 17:45540462-45540484 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1148212386 17:45816447-45816469 TGCAGTCCTGGGGGCAGAGACGG - Exonic
1148276135 17:46304988-46305010 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1148298252 17:46522564-46522586 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1148362792 17:47027030-47027052 TGTAGTCCTAGCCGCTCAGGAGG - Intronic
1148642542 17:49199191-49199213 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
1149086692 17:52726271-52726293 TGTAGTCCCAGGTGCTCAGGAGG - Intergenic
1149230338 17:54526382-54526404 TGTAGTCTTTTAGGCACAGAGGG + Intergenic
1149457620 17:56800925-56800947 TGTAGTCCTTGCTACTCAGGAGG + Intronic
1149675655 17:58459310-58459332 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1150259489 17:63777026-63777048 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1150404339 17:64887384-64887406 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1152276327 17:79359845-79359867 TGTAGTCCTTGCTGCTCAGGAGG - Intronic
1152654056 17:81511920-81511942 TGTTGGCCTTGGGGTTCAGGGGG + Exonic
1152888144 17:82864723-82864745 GGTTGTGCTTGGGGCACTGGGGG + Intronic
1153286830 18:3464427-3464449 TGTAGTCCTAGGTACTCAGGAGG - Intergenic
1153499164 18:5730692-5730714 TGTAGTCCCTGCTGCTCAGGAGG - Intergenic
1154227349 18:12518130-12518152 TGTAGTCCCTGCTGCTCAGGAGG - Intronic
1154342728 18:13517591-13517613 TGTGGTCCTGGAGGCACACGTGG + Intronic
1154975394 18:21452517-21452539 TGAAGTCCTCTGGGCACAGCTGG - Intronic
1155235818 18:23817591-23817613 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1155987638 18:32247097-32247119 AATAGTCTTTGGGGTACAGGTGG + Intronic
1156051249 18:32937042-32937064 TGTAGGCATTGGGGAACAAGTGG + Intergenic
1157411784 18:47469257-47469279 TGTGGTCATTGAGGCACAGTAGG - Intergenic
1158241173 18:55379993-55380015 TGTAGTCCTAGTGACCCAGGAGG - Intronic
1158621773 18:59039337-59039359 TGGAGTCCTTGGGATATAGGAGG + Intergenic
1159557778 18:69962967-69962989 TGTAGTCTTTGGGGCCAAGGAGG - Intergenic
1160172750 18:76568216-76568238 TGCAGTTCTTGGGGCACCCGTGG + Intergenic
1160195788 18:76754054-76754076 TGATGTCCTTGGGGCACCTGTGG + Intergenic
1160211354 18:76882929-76882951 AGTAGCCCGTGGGGCTCAGGCGG - Intronic
1161203934 19:3030474-3030496 TGTAGACACTGGGGCACAGCTGG + Intronic
1161833903 19:6631734-6631756 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
1162410949 19:10504673-10504695 TGTAGTCCCAGGTACACAGGAGG + Intergenic
1162415497 19:10534140-10534162 TGTAATCCTTGCTGCTCAGGAGG + Intergenic
1162915823 19:13873887-13873909 TGTAGGCCTGGGGGCACCCGGGG + Intronic
1163003440 19:14383079-14383101 TGTAGTCCTAGTGGCTCAGGAGG + Intronic
1163796324 19:19340209-19340231 TGTAGTCCCAGGTGCTCAGGAGG + Intronic
1164386963 19:27780026-27780048 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
1164639823 19:29816032-29816054 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1164983396 19:32630750-32630772 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1165206449 19:34192445-34192467 TGTAGTCCTAGCTGCTCAGGTGG - Intronic
1165225502 19:34351974-34351996 TGTAGTCCTAGCTGCCCAGGAGG + Intronic
1165415174 19:35688812-35688834 TGTAGTCCTAGCTGCACAGGAGG + Intergenic
1165430971 19:35772495-35772517 TGTAGTCCCAGGTGCTCAGGAGG + Intergenic
1165435937 19:35795008-35795030 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
1166033260 19:40148746-40148768 TGTAGTCCTAGGTACTCAGGAGG + Intergenic
1166212432 19:41315666-41315688 TGTAGTCCTGGCTGCTCAGGAGG + Intronic
1167400343 19:49263079-49263101 TGTAGTCCTAGCTACACAGGAGG + Intergenic
1168332730 19:55579396-55579418 GGAAGGCCTTGGGGCACAGCGGG + Exonic
1168470033 19:56632283-56632305 TGTAGTCCCTGCTGCTCAGGAGG + Intergenic
1168720838 19:58554264-58554286 TGTAGGGCATGGGGCCCAGGAGG + Exonic
926058792 2:9792484-9792506 TGTAGTCCTAGCTACACAGGAGG + Intergenic
926108417 2:10166797-10166819 TGGAGTGCTTAGGACACAGGCGG - Intronic
926196169 2:10764847-10764869 TGTAGTCCTTGCTGCTCGGGAGG + Intronic
926937035 2:18096391-18096413 TGTAGTCCCAGCGGCTCAGGAGG - Intronic
927643138 2:24858410-24858432 GGTAGTCCTTGGACCACAGCTGG - Intronic
927785536 2:25971827-25971849 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
927792921 2:26024739-26024761 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
927994052 2:27470121-27470143 TGTAGTCCTAGCTGTACAGGGGG + Intronic
928080110 2:28304000-28304022 TGTAGTCCTGGGTACTCAGGAGG - Intronic
928236623 2:29547473-29547495 TGTAGTCCTAGGTACTCAGGAGG + Intronic
928568549 2:32579565-32579587 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
929488250 2:42373940-42373962 TGTAGTCCTTGCTGCTCGGGAGG - Intronic
930019887 2:46995136-46995158 TGTTGTCCTTGGGGCAGTAGAGG - Exonic
930187971 2:48429001-48429023 TGTAGTCCTAGCTACACAGGAGG + Intergenic
930639105 2:53837278-53837300 TGTAGTCCTAGTTGCTCAGGAGG - Intergenic
931044331 2:58333353-58333375 TGTAGTCCTAGCTGCACAGGAGG + Intergenic
931160391 2:59683811-59683833 TGTAGTTTTTAGTGCACAGGCGG + Intergenic
931483529 2:62667627-62667649 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
932014714 2:68013052-68013074 TGTAGTCCTAGTGGCCCAGGAGG - Intergenic
932510955 2:72289781-72289803 TGTAGTCCCTGAGGCTGAGGTGG + Intronic
932559528 2:72855072-72855094 CTGAGTCCTTGGGGCACTGGGGG + Intergenic
933372954 2:81440520-81440542 AGTAGTTCTGGGGGCACAGGTGG - Intergenic
933785034 2:85832256-85832278 TGTAGTCCTAGCTACACAGGAGG + Intergenic
933924555 2:87079004-87079026 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
934668241 2:96189069-96189091 TGTAGTCCCTGCTACACAGGAGG - Intronic
934785793 2:97004740-97004762 TGTAGTCCTAGGTACTCAGGAGG - Intronic
935017488 2:99197760-99197782 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
935836083 2:107055406-107055428 TGTAGTATATGGGGCAGAGGTGG + Intergenic
937417663 2:121729684-121729706 TGTAGTCCTTGCTACTCAGGAGG - Intronic
937801544 2:126086313-126086335 TGTAGTCCTAGGTACTCAGGAGG + Intergenic
938377499 2:130818389-130818411 TGTAGTCCTAGGTACTCAGGAGG - Intergenic
938828258 2:135028433-135028455 TGTAGTCCTGGTGACTCAGGAGG + Intronic
938844873 2:135197914-135197936 TGTAGTCCTAGCTACACAGGAGG - Intronic
938943537 2:136190272-136190294 TGTACTCCTTGGGGGACAGAGGG - Intergenic
939340166 2:140884832-140884854 TGTAGTCCTTGCTACTCAGGAGG - Intronic
939459348 2:142479343-142479365 TGTAGTCCCAGGTGCTCAGGAGG - Intergenic
939879456 2:147613506-147613528 TGTAGTCCTAGCTACACAGGAGG - Intergenic
940341050 2:152581787-152581809 AGTAGTCCTTAGAGAACAGGTGG + Intronic
940768023 2:157810741-157810763 TGGAGACCTTGGGGCTGAGGAGG - Intronic
941187455 2:162334751-162334773 TGTAGAGCTTGGCACACAGGAGG + Intronic
941966306 2:171304289-171304311 TGTAGTCCTTGCCACTCAGGAGG + Intergenic
942122983 2:172796641-172796663 TGTAGTCCTAGCGACTCAGGAGG - Intronic
942358039 2:175140873-175140895 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
942581011 2:177416645-177416667 TGTAGTCCCAGGTGCTCAGGAGG - Intronic
943039395 2:182786571-182786593 TCTATTCCTTTGGGAACAGGAGG - Exonic
943524363 2:188997730-188997752 TGTAATCCTTGTGGACCAGGGGG - Exonic
943714969 2:191141210-191141232 AGTAGTTTTTGGGGTACAGGTGG - Intronic
944088291 2:195874698-195874720 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
944421201 2:199532431-199532453 AGAAGTCATTGGGGTACAGGTGG - Intergenic
944710458 2:202330570-202330592 TGTAGTCCTGGCTACACAGGAGG + Intergenic
944986165 2:205179961-205179983 TAGAGTCCTTTGGGCACAAGTGG + Intronic
945096311 2:206222863-206222885 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
945908077 2:215616240-215616262 TGTAGTCCTAGCTACACAGGAGG + Intergenic
946985306 2:225265484-225265506 TCTAGTCTTTGGAGCACAGTAGG + Intergenic
947428778 2:230007454-230007476 TGAAGCCCCTGGGGCACAGGTGG + Intronic
948220404 2:236265013-236265035 TGCACTCCTAGGGGCAAAGGTGG + Intergenic
948945235 2:241216013-241216035 TATAGTCCTTGGGGGAGATGTGG - Intronic
1168874404 20:1160905-1160927 TGTTGGCCTTGGGGTTCAGGGGG - Intronic
1169204304 20:3731718-3731740 TGTAGTCCTAGGTACTCAGGAGG - Intergenic
1169637185 20:7705506-7705528 TGTAGTCCTGGCGGCTCTGGAGG - Intergenic
1170447561 20:16444527-16444549 TGGAGTACTTGCGACACAGGTGG + Intronic
1170599390 20:17829291-17829313 TGTAGTCCTAGGTACTCAGGAGG + Intergenic
1171982071 20:31635292-31635314 TGTAGTCCCAGGTGCTCAGGAGG - Intergenic
1172123276 20:32610880-32610902 TGTAGGCCTGCTGGCACAGGTGG + Intergenic
1172163759 20:32886251-32886273 TGTAGTGCTTGGGGCAGGGCAGG + Intronic
1172704149 20:36870796-36870818 TGTAGTCCTAGGTACTCAGGAGG + Intergenic
1173623748 20:44456304-44456326 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1173709670 20:45143581-45143603 TGTAGTCCTTGTGGCCTAGACGG + Intergenic
1174352387 20:49977863-49977885 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1174657618 20:52184746-52184768 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1174816184 20:53689327-53689349 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
1174967323 20:55232369-55232391 TGTAGTCCTTGCTACTCAGGAGG + Intergenic
1175086930 20:56467613-56467635 TGTAGTCCTAGCGGCTCCGGAGG - Intergenic
1175513431 20:59551491-59551513 TGTAGTCCCAGGGACTCAGGAGG - Intergenic
1176211368 20:63924505-63924527 TGTGGTCCTAGTGACACAGGAGG - Intronic
1176880087 21:14181686-14181708 TGTAGACCTTGGGCAAGAGGAGG - Intronic
1177798632 21:25805781-25805803 TATAGTCCTAGTGACACAGGAGG - Intergenic
1177961282 21:27669876-27669898 TGAATTCTTTGGGGCTCAGGTGG + Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1178752572 21:35318469-35318491 TGTTGTCATTAGGGCAGAGGTGG - Intronic
1179792953 21:43766054-43766076 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1180257875 21:46645836-46645858 TGTAGTCCCAGGTACACAGGAGG - Intronic
1181112076 22:20608070-20608092 TGTAGTCCTAGTGACTCAGGAGG + Intergenic
1181439514 22:22928564-22928586 TGTGATCCTTGGGCCACAGTGGG + Intergenic
1181563978 22:23722752-23722774 TGTAGTCCTAGTTGCTCAGGAGG + Intergenic
1181584972 22:23848244-23848266 TGCATTCCTTGGGGCGGAGGGGG - Intergenic
1181969297 22:26678123-26678145 TGTAGTCCTTTGAGGGCAGGGGG - Intergenic
1182058416 22:27379272-27379294 TGTAGTCCTAGCAGCTCAGGAGG + Intergenic
1182514753 22:30849144-30849166 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1182671053 22:31996412-31996434 TGTAGTTCTGTGGGCACAGAGGG + Intergenic
1183065044 22:35356917-35356939 TGTAGTCCTAGGTACTCAGGAGG - Intergenic
1183279924 22:36926532-36926554 TGTGGCCCTTGAGGCCCAGGAGG + Intronic
1183764164 22:39855227-39855249 TGTAGGCCTTGGAGAACAGAAGG - Intronic
1183798720 22:40143309-40143331 TGTAGTCCTAGCTGCCCAGGAGG + Intronic
1183911100 22:41079976-41079998 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1183924547 22:41196930-41196952 TGTAATCTTTGAGGCAGAGGTGG - Intergenic
1185052995 22:48563425-48563447 TGAACTCCTCTGGGCACAGGTGG + Intronic
949459270 3:4272951-4272973 TGTAGTCCTGGCTACACAGGAGG + Intronic
949485110 3:4530657-4530679 TGTAGTCCCTGCTACACAGGAGG + Intronic
949983512 3:9519678-9519700 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
950085458 3:10254408-10254430 TGGAGTGCTTGGGGCACTGCTGG + Intronic
950222603 3:11207445-11207467 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
950235202 3:11313722-11313744 TGTAGTCCCAGGTGCTCAGGAGG - Intronic
950511005 3:13426875-13426897 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
950635045 3:14308391-14308413 TGGAGTTCTGGGGGCCCAGGTGG - Intergenic
950817318 3:15719688-15719710 TGTAGTCCTAGGTACTCAGGAGG - Intronic
951647821 3:24913100-24913122 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
952303236 3:32123024-32123046 TGTAGTCCTAGCGACTCAGGAGG - Intronic
952355814 3:32582948-32582970 TGTAGTCCTTGCTACTCAGGAGG + Intergenic
952622523 3:35362633-35362655 TGAAGTCTTTGGGACACAGCAGG - Intergenic
952994290 3:38862865-38862887 AGTAGTTTTTGGGGAACAGGTGG - Intronic
953049066 3:39324142-39324164 TGTAGTCCCAGGTGCTCAGGAGG - Intergenic
953649623 3:44790297-44790319 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
953840429 3:46385860-46385882 TGTAGTCCCTGCTGCTCAGGAGG - Intergenic
953900640 3:46840137-46840159 TGTAGTCCTAGGTGCTCTGGAGG + Intergenic
954217493 3:49132715-49132737 AGTTGCCCTTGGGGCACATGAGG - Intronic
954331204 3:49891300-49891322 TGGGGTTCTGGGGGCACAGGTGG + Exonic
955716347 3:61834437-61834459 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
955788497 3:62564726-62564748 TGTAGTCCTAGCTGCTCAGGTGG - Intronic
955959961 3:64330426-64330448 TGTAGTGCTTGGTACACAGTAGG + Intronic
956087733 3:65630834-65630856 AGTAGTGTTTGGGGTACAGGTGG - Intronic
956184064 3:66545625-66545647 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
956440762 3:69278418-69278440 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
957743619 3:84307237-84307259 TTTAATCCTTGGAGCAGAGGAGG + Intergenic
960111262 3:113847724-113847746 TGTAGTCCCAGGGGCTCAGGAGG + Intronic
961167252 3:124772017-124772039 TCTAGTCCTTGGGGCACACTAGG - Intronic
961918504 3:130401822-130401844 TGTAGTCCTCGGGTCCCATGAGG - Exonic
963180972 3:142355730-142355752 TGTAGTCCTAGCTCCACAGGAGG - Intronic
964837850 3:160959421-160959443 AGTAGTTTTTGGGGAACAGGTGG - Intronic
967426661 3:189335143-189335165 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
967940160 3:194759448-194759470 TGTAGTCCCAGGTGCTCAGGAGG + Intergenic
968420704 4:482283-482305 TGTAATCCTAGTGGCTCAGGAGG - Intronic
968986511 4:3878416-3878438 TGCAGTCCATGGGCCACAGTTGG + Intergenic
969255740 4:6000577-6000599 TGGAGTCCGTGGGTCACTGGGGG - Intergenic
969380685 4:6795190-6795212 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
971009840 4:22421756-22421778 TGTAGTCCTAGCGACTCAGGAGG + Intronic
971543189 4:27848458-27848480 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
972319260 4:37957495-37957517 TGTAGTCCTAGGTACTCAGGAGG + Intronic
972331896 4:38071686-38071708 TGTAGTCCTTGGCACACTGTAGG + Intronic
973315525 4:48756109-48756131 TGTAGTCCCAGGTGCTCAGGAGG + Intronic
975198308 4:71552979-71553001 TTTAGTTCATGGGTCACAGGAGG - Intronic
975561610 4:75713665-75713687 TGTAGTCCTAGCGACTCAGGAGG + Intronic
976114727 4:81714710-81714732 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
976272738 4:83247563-83247585 TGTAGCACCTGGGCCACAGGGGG - Intergenic
976421045 4:84844474-84844496 TGAAATCCTTGGGGGACAGCAGG + Intronic
976652196 4:87447908-87447930 TGTAGTCCTAGCTACACAGGAGG + Intronic
976972227 4:91118394-91118416 TGTAGTCCTAGGTACTCAGGAGG - Intronic
977092306 4:92692940-92692962 TTGAGTCCTGGGGGCAGAGGTGG + Intronic
977603129 4:98955556-98955578 TGTAGTCCCAGGTGCTCAGGAGG - Intergenic
977695512 4:99960525-99960547 AGTAGTTTTTGGGGAACAGGTGG - Intergenic
977963012 4:103107125-103107147 TGTAGTCCTTGATGCTTAGGAGG + Intronic
978141212 4:105319262-105319284 TGTAGTCCTTGCTACTCAGGAGG + Intergenic
978452643 4:108852246-108852268 TGTAGTCCTTGAGGTCCAGGAGG + Exonic
978947881 4:114520049-114520071 AGTAGTTTTTGGGGAACAGGTGG + Intergenic
979463336 4:121007648-121007670 AGTAGTTTTTGGGGTACAGGTGG - Intergenic
979642843 4:123029757-123029779 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
980945943 4:139320640-139320662 TGTAGTCCCAGCGGCTCAGGAGG - Intronic
981508926 4:145533560-145533582 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
981678744 4:147370099-147370121 TGTAGTCCTAGGTACTCAGGAGG - Intergenic
981953804 4:150445784-150445806 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
982222353 4:153135815-153135837 TGTAGTCCTGGGTACTCAGGAGG + Intergenic
983078410 4:163354563-163354585 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
984566456 4:181336742-181336764 TGTAGTCCCTGCTGCTCAGGAGG + Intergenic
985112581 4:186561192-186561214 TGTAGTCCTGGGTACTCAGGAGG + Intergenic
985251512 4:188028914-188028936 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
985777731 5:1853669-1853691 TGGAGTCCGTGGTGCACCGGAGG + Intergenic
986546073 5:8898594-8898616 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
986710379 5:10484321-10484343 TGTAGTCCTAGTGACTCAGGAGG + Intergenic
987068872 5:14317140-14317162 TGCAGTCCATGGTGCACAGTAGG + Intronic
988527443 5:31999389-31999411 TGTAGTCCTAGGTACTCAGGAGG + Intronic
990441930 5:55855263-55855285 TGTAGTCCTAGCTACACAGGAGG - Intronic
990468584 5:56092274-56092296 TGTAGTCCCAGGGGCCGAGGTGG + Intergenic
991047832 5:62241270-62241292 TGTAGTCCTTGGAGCTGAGGTGG - Intergenic
991289941 5:65023855-65023877 TGTAGTCCTAGGTACTCAGGAGG + Intergenic
991581494 5:68160232-68160254 TGTAGTCTTTGGGCCTCTGGGGG - Intergenic
992020365 5:72618024-72618046 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
992355134 5:75973371-75973393 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
992797431 5:80265721-80265743 TGTAGTCCTAGAGGCTCAGCAGG - Intergenic
992999599 5:82367175-82367197 TGTAGTCCCAGGTGCTCAGGAGG + Intronic
993547282 5:89229266-89229288 TGAAGTCCTTGGTGCAAGGGAGG + Intergenic
993762000 5:91806951-91806973 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
993797286 5:92283200-92283222 AGTAGTTATTGGGGTACAGGTGG - Intergenic
994084083 5:95739671-95739693 TGTAGTCCTTGCTACTCAGGAGG - Intronic
996816101 5:127573969-127573991 TGTAGTCCTAGCTACACAGGAGG + Intergenic
997128194 5:131249759-131249781 TGTAGTCCTAGGTACTCAGGAGG + Intronic
997210798 5:132075561-132075583 TGCACTCCTTGGGGAACACGTGG + Intronic
997329061 5:133046006-133046028 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
997539935 5:134653369-134653391 TGTAGTCCTAGCTTCACAGGAGG - Intronic
997939968 5:138148487-138148509 TGTAGTCCTAGCTACACAGGAGG - Intronic
998005924 5:138657028-138657050 TGTGGTCCCTGGGGCTGAGGTGG + Intronic
998187775 5:139995892-139995914 TGTAGTCCTAGGTACTCAGGAGG + Intronic
998622751 5:143812577-143812599 CGTTGTCCTTGTGGCTCAGGTGG - Intronic
999754941 5:154657287-154657309 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1000220957 5:159213590-159213612 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
1000877131 5:166654748-166654770 TGTAGTCTTTGGGGGCCAGAAGG + Intergenic
1000901212 5:166913715-166913737 TGTAGTGCCTGGTGCACAAGAGG - Intergenic
1001051768 5:168419644-168419666 GGTAGTCTGTGGGCCACAGGCGG + Intronic
1001833136 5:174806341-174806363 TGTAGTCCTAGTAGCTCAGGAGG - Intergenic
1002122908 5:177019518-177019540 TGTAGTCCTTGCTACTCAGGAGG + Intronic
1002168283 5:177361438-177361460 CTCAGCCCTTGGGGCACAGGTGG - Intronic
1002525515 5:179813642-179813664 TGTAGTCCTAGCTGCTCAGGGGG + Intronic
1002804417 6:558689-558711 TGTAGTCCTAGGTACTCAGGAGG + Intronic
1003028908 6:2583513-2583535 CATAGTTATTGGGGCACAGGTGG + Intergenic
1003095177 6:3137096-3137118 TGTAGGCCCTGGGGTACAGTGGG + Intronic
1003382000 6:5633218-5633240 TGTAGTCCTTGTTACTCAGGAGG - Intronic
1003760820 6:9176950-9176972 TGTAGTTCAAGGGGCTCAGGAGG - Intergenic
1003861732 6:10328123-10328145 TGTAGTCCTAGGTACTCAGGAGG + Intergenic
1004148132 6:13089207-13089229 AGAAGCCCCTGGGGCACAGGTGG + Intronic
1004460240 6:15828488-15828510 TGTAGTCCAGGTGGCACAGCTGG - Intergenic
1004543230 6:16571611-16571633 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1005051413 6:21687320-21687342 TGTAGTCCTAGCTGCTCAGGTGG + Intergenic
1005255303 6:23996370-23996392 AGTAGTTTTTGGGGAACAGGTGG - Intergenic
1006011954 6:31049923-31049945 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1006705850 6:36020495-36020517 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1007037005 6:38684100-38684122 TGTAGTCCAAGGTGCTCAGGAGG + Intronic
1007254182 6:40517074-40517096 TCTAGTCCTTTTGCCACAGGAGG - Intronic
1007607152 6:43125297-43125319 CCCAGTCGTTGGGGCACAGGGGG + Intronic
1007702477 6:43772978-43773000 TTTCCTCCTTGGGGCCCAGGAGG + Intronic
1008321413 6:50118696-50118718 TGTAGTCCTAGGTACTCAGGAGG + Intergenic
1008391367 6:50956004-50956026 TGTAGTCCTTGCTACTCAGGAGG - Intergenic
1008568522 6:52792730-52792752 TGGAGACCTTGGGGCACTGAAGG + Intronic
1008793427 6:55268966-55268988 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1009342336 6:62571707-62571729 TGTAGTCCCTGGTACTCAGGAGG - Intergenic
1009416691 6:63423500-63423522 TGTAGTCCTAGCTACACAGGAGG + Intergenic
1009511177 6:64551656-64551678 TGTGGTCCTTGGTACTCAGGAGG - Intronic
1010020321 6:71152203-71152225 TGTAGGCCTTGGAGCACGGAGGG + Intergenic
1010240481 6:73611123-73611145 TGTAGTCCTGGCTGCTCAGGAGG + Intronic
1010439802 6:75880565-75880587 TGTAGTCCATGGGCCACATGTGG - Intronic
1010464712 6:76153633-76153655 TGTAGTCCCAGGTGCTCAGGAGG + Intergenic
1010557186 6:77296954-77296976 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1011589612 6:88959326-88959348 AGTAGTTTTTGGGGGACAGGTGG - Intronic
1011607777 6:89120749-89120771 TGTAGTCCTAGCTGCTCAGGTGG + Intergenic
1012273201 6:97240513-97240535 AATAGTCTTTGGGGAACAGGTGG + Intronic
1012404025 6:98873705-98873727 TGTAGTCCTAGCGACACAGGAGG - Exonic
1012934537 6:105352605-105352627 TGCAATCCTAGGGGCTCAGGAGG - Intronic
1013033477 6:106358882-106358904 TGTAGTCCTGGCTGCTCAGGAGG + Intergenic
1013551313 6:111210523-111210545 GCTGGTGCTTGGGGCACAGGAGG - Intronic
1014069809 6:117168332-117168354 ATTACTCCTTTGGGCACAGGAGG - Intergenic
1014248841 6:119095678-119095700 TGTAGTCCTAGCTACACAGGAGG - Intronic
1015165744 6:130198324-130198346 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1015215650 6:130746893-130746915 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1016179081 6:141121414-141121436 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
1016301782 6:142639804-142639826 TGAAGTCCTTAGGGCAAAAGTGG - Intergenic
1016387943 6:143546913-143546935 TGTAGTCCTTGCTACTCAGGAGG + Intronic
1017472827 6:154757116-154757138 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1017774647 6:157671314-157671336 TGAAGACCCTGGGGCACAGATGG - Intronic
1017901660 6:158723214-158723236 TGTAGTCCTAGCTACACAGGAGG - Intronic
1018946285 6:168348488-168348510 TTTAGCCCTTGTGGGACAGGAGG + Intergenic
1019115899 6:169762205-169762227 TGTAGTCCTAGCTACACAGGAGG - Intronic
1019197174 6:170289661-170289683 GGTAGTGCTTGAGGCACACGCGG + Exonic
1019532854 7:1512251-1512273 TGTAGTTCTAGTGGCTCAGGAGG - Intergenic
1019630553 7:2046704-2046726 TGTGGCCCCTTGGGCACAGGCGG - Intronic
1019773044 7:2895770-2895792 TGTAGTCCTTGCTACTCAGGAGG - Intergenic
1019970460 7:4536488-4536510 TGGAGTCCCTGGGGCACTGATGG + Intergenic
1020152964 7:5697602-5697624 TGTAGTCCCAGCTGCACAGGAGG - Intronic
1020264987 7:6554434-6554456 TGTAGTCCTAGCGACTCAGGAGG + Intergenic
1020446377 7:8272913-8272935 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1021058042 7:16075077-16075099 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1021724717 7:23537833-23537855 TATAGTTTTTGGGGAACAGGTGG - Intergenic
1022118747 7:27286367-27286389 TGTAGCCCATGGGCCACATGTGG + Intergenic
1022366324 7:29722603-29722625 TGTAGTCCTTGATACACAGTTGG - Intergenic
1022400686 7:30034128-30034150 TGTAGTCCTAGGTACTCAGGAGG - Intronic
1022931419 7:35119416-35119438 TGTAGTCCTTGATACACAGTTGG + Intergenic
1023186040 7:37534056-37534078 TGTAGTCCTTGTTACCCAGGAGG - Intergenic
1024296770 7:47850141-47850163 AGTAGTTTTTGGGGAACAGGTGG - Intronic
1025588022 7:62817759-62817781 TGTAGTCCCTGCTGCTCAGGAGG + Intergenic
1026197106 7:68182657-68182679 TGTAGTCCTAGCTACACAGGAGG - Intergenic
1026206356 7:68261153-68261175 TGTAGTCCTAGGTACTCAGGAGG + Intergenic
1026506265 7:70986922-70986944 TGTAGTCCCTGGTACTCAGGGGG + Intergenic
1026583174 7:71634630-71634652 TGTAGTCCCAGCTGCACAGGAGG + Intronic
1026682952 7:72483404-72483426 TGTAGTCCTAGCTACACAGGAGG - Intergenic
1027170872 7:75871360-75871382 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1027383228 7:77634076-77634098 TGTAGTCCTTGCTACTCAGGAGG + Intronic
1027731081 7:81873432-81873454 TATAGTTTTTGGGGAACAGGTGG - Intergenic
1028372961 7:90115487-90115509 TGTAGTCCTTGCTACTCAGGAGG + Intergenic
1028380826 7:90196687-90196709 TGTAGTCCTAGCTGCTCAGGCGG - Intronic
1028541409 7:91946491-91946513 TGTAGTCCCAGGTGCTCAGGAGG - Intronic
1029163649 7:98570750-98570772 TGTAGTCCCCGTGGCTCAGGAGG + Intergenic
1029247184 7:99210708-99210730 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
1029295625 7:99538189-99538211 TGTAGTCCCTGCTGCTCAGGAGG - Intergenic
1029833326 7:103282754-103282776 TGTAGTCCTTGCTACTCAGGAGG - Intergenic
1030133597 7:106224235-106224257 TGTAGTCCTAGCTACACAGGAGG - Intergenic
1030201390 7:106909211-106909233 TGTAGTCCTGGGTACTCAGGAGG + Intergenic
1030435095 7:109507914-109507936 TGTAGTCCTAGGTACTCAGGAGG + Intergenic
1031055567 7:116989715-116989737 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1031583906 7:123510170-123510192 TGTTATCATTGGGGCACAGCAGG - Intronic
1032968665 7:137132423-137132445 TGTAGTCCTAGGTACTCAGGAGG + Intergenic
1033316185 7:140299627-140299649 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1033490674 7:141840678-141840700 TGTAGTCCTTGCCCCACATGGGG - Intronic
1034209810 7:149353541-149353563 TGTAGTCCTAGCTACACAGGAGG + Intergenic
1034610722 7:152365862-152365884 TGTAGTCCTGGGTACTCAGGAGG + Intronic
1035944079 8:3939985-3940007 AGTAGTTTTTGGGGTACAGGTGG - Intronic
1036074341 8:5478013-5478035 TGTAGTCCCTGCTGCTCAGGAGG + Intergenic
1036182906 8:6600356-6600378 TGTAGCCCTCAGCGCACAGGTGG + Intronic
1037687428 8:21154928-21154950 TGTAGTCCCAGCTGCACAGGAGG - Intergenic
1038741408 8:30220178-30220200 TGTAGTCCTTGCTACTCAGGAGG + Intergenic
1039693679 8:39887093-39887115 TGGAGTCCTTGAGGCAGGGGAGG + Intergenic
1039942423 8:42102548-42102570 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1039969138 8:42306763-42306785 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1040001218 8:42578053-42578075 TGTAGTCCTAGGTACTCAGGAGG - Intergenic
1041386964 8:57314305-57314327 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1041665604 8:60441892-60441914 AGTAGTCATTTGGGAACAGGTGG + Intergenic
1042113386 8:65405399-65405421 TGCAGGCAGTGGGGCACAGGAGG - Intergenic
1042286845 8:67123016-67123038 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1042930859 8:74013076-74013098 TGTAGTCCTTGCTACTCAGGAGG - Intronic
1043398414 8:79860187-79860209 TGTAGTCCTAGTTGCTCAGGAGG - Intergenic
1043576182 8:81660210-81660232 TGCAGTCCATGGGCCACATGTGG - Intronic
1043939849 8:86185176-86185198 TGTAGTCCTAGATGCTCAGGAGG + Intergenic
1045406792 8:101874644-101874666 TGTAGTCCTTGCTGTTCAGGAGG - Intronic
1045938301 8:107709023-107709045 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
1046437177 8:114206147-114206169 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
1047276879 8:123412552-123412574 TGTAGTCCTAGGCACCCAGGAGG - Intronic
1047916264 8:129587127-129587149 TATAGTCCTTGGGTCACTGTGGG - Intergenic
1048351226 8:133618318-133618340 TATAGTCCTGGGGACACAGAAGG + Intergenic
1049483975 8:142841828-142841850 TGTATGCCCTGGCGCACAGGTGG + Intronic
1049996171 9:1036058-1036080 TGTAGTCCTAGCAGCTCAGGAGG - Intergenic
1050102115 9:2129973-2129995 TGTAGTCCTAGGTACTCAGGAGG - Intronic
1050441334 9:5667198-5667220 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1050455488 9:5830986-5831008 TGTAGTCCTGGGGCCAATGGAGG + Exonic
1050566163 9:6886432-6886454 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1051326373 9:15975023-15975045 TGTAGTCCCTGGTACTCAGGAGG - Intronic
1051471914 9:17453189-17453211 TGTAGTCCCTGCTGCTCAGGAGG + Intronic
1052306927 9:27020789-27020811 AGTAGTTTTTGGGGAACAGGTGG + Intronic
1052602182 9:30647925-30647947 TGTAGTCCTAGCTACACAGGAGG + Intergenic
1052847322 9:33348468-33348490 AATAGTTCTTGGGGAACAGGTGG - Intronic
1053262765 9:36684617-36684639 AGTAGTTTTTGGGGTACAGGTGG + Intergenic
1055324532 9:75115411-75115433 TGTAGTCCTTGCTACTCAGGAGG - Intronic
1055443264 9:76357393-76357415 TGTAGTCCTAGCTACACAGGAGG + Intronic
1056696754 9:88863384-88863406 TGTAGTCCTAGCTACACAGGAGG - Intergenic
1056722346 9:89082723-89082745 TGGGGTCCGTGGGGCATAGGAGG - Intronic
1057919036 9:99081602-99081624 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1059037544 9:110773122-110773144 TGTAGTACTTGGAGCCCAGAAGG - Intronic
1059263843 9:113007070-113007092 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1059299969 9:113304463-113304485 TGTAGTCCTAGGTACTCAGGAGG - Intergenic
1060645610 9:125276878-125276900 TGTAGTCCTAGGTTCTCAGGAGG - Intronic
1061050993 9:128194937-128194959 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1061102080 9:128499729-128499751 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1061132091 9:128713965-128713987 TGTAATCCCAGGGGCAGAGGAGG + Intronic
1061966536 9:134017496-134017518 TGTGGTCCATGGGTCACAAGAGG + Intergenic
1062028277 9:134350524-134350546 TGTCTTCCTTCGGGCACAGCAGG + Intronic
1062361553 9:136190669-136190691 TGGGGTCCTTGGGGCCCAGCAGG - Intergenic
1062420479 9:136478710-136478732 TGTAGTCCCAGGGACTCAGGGGG + Intronic
1185473802 X:401141-401163 TGTGGTCCCTGGTGCTCAGGAGG - Intergenic
1185841462 X:3395536-3395558 TGTAGTCCTAGAGCCTCAGGAGG - Intergenic
1187108654 X:16272349-16272371 TGTAGTCCTAGCTGCTCAGGAGG - Intergenic
1187351752 X:18525218-18525240 TGTAGTCCTTGCAACTCAGGAGG - Intronic
1187356431 X:18577016-18577038 TGTAGTCCTAGCGACTCAGGAGG - Intronic
1187418975 X:19118505-19118527 TGTAGTCCTTGCTACTCAGGAGG - Intronic
1187647262 X:21361710-21361732 TGTAGTCCTTGCTACTCAGGAGG + Intergenic
1187718984 X:22132219-22132241 TGTAGTCCTAGGTACTCAGGAGG - Intronic
1188244414 X:27822891-27822913 TGTAGTCCTAGCTGCTCAGGAGG + Exonic
1188786437 X:34352352-34352374 TGTAGTCCTTGCTACTCAGGAGG + Intergenic
1189503409 X:41585622-41585644 TGTAGTCCTAGCTGCTCAGGAGG + Intronic
1189724175 X:43952111-43952133 TGTAGTCCTGGCTACACAGGAGG - Intronic
1189957326 X:46288782-46288804 GGTTGGCCTTGGGGCTCAGGGGG + Intergenic
1190068899 X:47263139-47263161 TGTAGTCCTAGGTACTCAGGAGG - Intergenic
1190244618 X:48683204-48683226 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1190589692 X:51987271-51987293 TGTAGTCCTAGGTACTCAGGAGG - Intergenic
1190870780 X:54423056-54423078 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1192115639 X:68408059-68408081 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1192353136 X:70373148-70373170 TGTAGTCCTTGCTACTCAGGAGG + Intronic
1192904334 X:75534359-75534381 AGTAGTTTTTGGGGAACAGGTGG + Intergenic
1193112581 X:77744193-77744215 TGTAGTCCTAGGTACTCAGGAGG + Intronic
1193821867 X:86174797-86174819 TGTAGTCCTAGCTGCTCAGGGGG - Intronic
1194422044 X:93687461-93687483 AATAGTTTTTGGGGCACAGGTGG - Intronic
1194668647 X:96704048-96704070 TGTAGTCCTAGCTGCTCAGGAGG - Intronic
1194865711 X:99063465-99063487 TGTAGTCCTGGGAGCTAAGGAGG + Intergenic
1195375967 X:104228598-104228620 TGTAGTCCTAGCAGCTCAGGAGG + Intergenic
1197011504 X:121570168-121570190 TGCAGTCCTTGTGGCCCAGATGG - Intergenic
1197810452 X:130437226-130437248 TGTAGTCCTGGCTGCTCAGGAGG + Intergenic
1198098417 X:133402779-133402801 TGTAGTCCCAGCTGCACAGGAGG + Intronic
1198180918 X:134208292-134208314 TGTAGTCCTGGGTACTCAGGAGG - Intergenic
1198475482 X:136992963-136992985 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1199424767 X:147688286-147688308 AGTAGTTTTTGGGGAACAGGTGG - Intergenic
1199723511 X:150560322-150560344 TGTAGTCCTAGCTACACAGGAGG - Intergenic
1200130813 X:153844146-153844168 TGTAGTCCTAGCTGCTCAGGAGG + Intergenic
1201784353 Y:17757783-17757805 TGTTGTCCTTGGGGTTCAGTGGG + Intergenic
1201817200 Y:18148204-18148226 TGTTGTCCTTGGGGTTCAGTGGG - Intergenic
1201942718 Y:19477031-19477053 TGTAGTCCTAGCTACACAGGAGG + Intergenic