ID: 1077229874

View in Genome Browser
Species Human (GRCh38)
Location 11:1453958-1453980
Sequence CTCTTGAGCTGGAGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 353}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077229869_1077229874 3 Left 1077229869 11:1453932-1453954 CCGCGCTGGTGGGTGGGGTTCGG 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG 0: 1
1: 0
2: 2
3: 32
4: 353
1077229866_1077229874 6 Left 1077229866 11:1453929-1453951 CCCCCGCGCTGGTGGGTGGGGTT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG 0: 1
1: 0
2: 2
3: 32
4: 353
1077229862_1077229874 11 Left 1077229862 11:1453924-1453946 CCTGGCCCCCGCGCTGGTGGGTG 0: 1
1: 0
2: 0
3: 22
4: 199
Right 1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG 0: 1
1: 0
2: 2
3: 32
4: 353
1077229868_1077229874 4 Left 1077229868 11:1453931-1453953 CCCGCGCTGGTGGGTGGGGTTCG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG 0: 1
1: 0
2: 2
3: 32
4: 353
1077229867_1077229874 5 Left 1077229867 11:1453930-1453952 CCCCGCGCTGGTGGGTGGGGTTC 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG 0: 1
1: 0
2: 2
3: 32
4: 353
1077229857_1077229874 29 Left 1077229857 11:1453906-1453928 CCTCTCACGGCTGGGCTTCCTGG 0: 1
1: 0
2: 0
3: 20
4: 240
Right 1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG 0: 1
1: 0
2: 2
3: 32
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077229874 Original CRISPR CTCTTGAGCTGGAGAGCAGA GGG Intronic
900236641 1:1594749-1594771 CCATGGAGCTGGAGCGCAGATGG - Intergenic
901150455 1:7097805-7097827 CTCTGGAGATGGAAAGTAGATGG + Intronic
902868255 1:19295456-19295478 CCCTTGGTCTGGAGAGCACATGG - Intergenic
903487467 1:23701360-23701382 TGCTTGAGCTGGAGAGGTGAAGG + Intergenic
903580660 1:24368156-24368178 CCCTAGACCTGGAGGGCAGAAGG + Intronic
903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG + Intronic
903872962 1:26450194-26450216 CTCCTGGGCTGGAGTGCAGTGGG + Intronic
905304939 1:37011079-37011101 CTCTGGAGTTGGAAAGCACATGG - Intronic
906518522 1:46453598-46453620 CTATTGCACTGCAGAGCAGAGGG - Intergenic
906534961 1:46546323-46546345 CTCTTGAGAGTGGGAGCAGAGGG - Intronic
907528640 1:55070549-55070571 CTGCTGAGTTGGAGAGAAGAGGG + Intronic
908868163 1:68576070-68576092 CCCTTGGCCTTGAGAGCAGAGGG - Intergenic
909922869 1:81403346-81403368 CTCTTGAGCCCGAGAGGAGGAGG - Intronic
910562345 1:88604110-88604132 CACTTGAGCTGGGGAGGAGGAGG + Intergenic
910655472 1:89614125-89614147 CTCAGGAGTTGGAGAGCAGCTGG - Intergenic
912518222 1:110228876-110228898 CTCTGGAACCGGAGAGCAAAGGG + Intronic
912906127 1:113709150-113709172 CACTTGAGCTGGAGAGGTTAAGG + Intronic
914474479 1:148011973-148011995 CTGGTGAGCTGGAGAGCCGGGGG - Intergenic
915041544 1:152972023-152972045 TTCTTGACCTGGGGAGCACATGG - Exonic
915473955 1:156141507-156141529 CTCTTGAGGAGGAGGGCTGAGGG + Intergenic
915776315 1:158491615-158491637 CTCATGAGCTGGAGAGTATGTGG + Intergenic
915974253 1:160374809-160374831 TGCCTGGGCTGGAGAGCAGAAGG + Intergenic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
917725046 1:177820423-177820445 CTCTTCAGCTGGACACCAGGAGG + Intergenic
919023476 1:192137914-192137936 CTCTTCAGCTGGAGAGGAGGAGG + Intergenic
920357075 1:205381752-205381774 ATCGAGAGCTGGAGAGAAGAAGG - Exonic
922584931 1:226726590-226726612 CTCTTGAGCTGGAGAGATCGAGG + Intronic
923196313 1:231671532-231671554 GTGTTGAGCTGGGGAGAAGAAGG - Intronic
924710932 1:246529487-246529509 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1065245737 10:23755166-23755188 TTCCTGAGCTGGAGAGCAAATGG + Intronic
1065624159 10:27613603-27613625 CTTTTTCGCTGGAGAGCAGGTGG + Intergenic
1068496327 10:57789162-57789184 CCCTTGGTCTGGAGAGCATATGG + Intergenic
1069746027 10:70715575-70715597 CTGCTGAGGTGGAGAGCTGAAGG + Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070751532 10:78966879-78966901 CTCATGGGCAGGAGGGCAGATGG - Intergenic
1070798665 10:79232061-79232083 CTCTAAAGCAGGAGAGCAGGAGG - Intronic
1071096039 10:81975961-81975983 CTCTAGAGCTGGAAAGGACAAGG + Intronic
1071391277 10:85177528-85177550 CTCTTGAGCTGTATCTCAGAGGG + Intergenic
1071468973 10:85965923-85965945 CTCTGGAGCTGGGGAGGAGGTGG - Intronic
1072076188 10:91976413-91976435 CTCTGGAGGTGGGGAGCAGGAGG + Intronic
1072404077 10:95133262-95133284 CCCTTGGTCTGGAGAGCATATGG - Intergenic
1074399715 10:113131925-113131947 CACATCAGCTGGAGATCAGAGGG + Intronic
1075306839 10:121375541-121375563 CTTTTGGTCTGGAGAGGAGATGG - Intergenic
1075392650 10:122103737-122103759 GTCCTGAGCTGTAGAGCTGAGGG + Intronic
1075522424 10:123150915-123150937 CTCTTGAGCTGGATTCCAGCCGG - Intergenic
1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG + Intronic
1077645575 11:3920694-3920716 ATCTTGGCCAGGAGAGCAGAAGG - Intronic
1079796725 11:24813156-24813178 CTCTTGTTCAGGAGATCAGATGG - Intronic
1080411872 11:32032732-32032754 CGCTGCTGCTGGAGAGCAGAAGG - Intronic
1081491752 11:43574950-43574972 CTCTTCGGGTGGAGAGCAGAGGG + Intronic
1081525986 11:43928147-43928169 ATGTTGAGCTGGAGGGGAGACGG + Intronic
1081610049 11:44556522-44556544 CTCTTGGGCTGGAGCGCAGTGGG + Intergenic
1082252304 11:49995723-49995745 CGCTTGGTCTGGAGAGCACATGG + Intergenic
1082889006 11:58118565-58118587 TTCTTAAGCTGTAGATCAGAGGG + Exonic
1083725017 11:64623386-64623408 CCTTGGAGCTGGAGAGGAGAGGG - Intronic
1084000620 11:66293551-66293573 GTCTTGGGGTGGGGAGCAGATGG - Intronic
1085470432 11:76754053-76754075 CTCCTGAGCTGGAGACCCCATGG - Intergenic
1088913273 11:114208123-114208145 CTATGGTGCTGGAGACCAGAAGG - Intronic
1088952654 11:114586991-114587013 CCCTTGGTCTGGAGAGCACATGG + Intronic
1089004170 11:115077083-115077105 TTCATGAACTGGAGAGCAAATGG + Intergenic
1089197830 11:116705327-116705349 CACTTGAGCTGGAGAGATGGAGG - Intergenic
1090292050 11:125554225-125554247 CCCTTGGTCTGGAGAGCACATGG - Intergenic
1090331063 11:125932558-125932580 GGCTTGGGCTGGGGAGCAGAGGG - Intergenic
1090694479 11:129224560-129224582 CTGTGGAGCTGCAGATCAGAGGG - Intronic
1091739421 12:2949816-2949838 CGCTTGAACTGGGGAGCTGAAGG - Intergenic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092523221 12:9294077-9294099 CTTTTGAGCTGGAGGTCAGCAGG + Intergenic
1092544071 12:9437822-9437844 CTTTTGAGCTGGAGGTCAGCAGG - Intergenic
1095334846 12:41012134-41012156 CCCTTGGTCTGGAGAGCACATGG - Intronic
1095334852 12:41012175-41012197 CCCTTGATCTGGAGAGCACATGG - Intronic
1095412712 12:41941722-41941744 CTCTTGTGTTGAAGAGGAGAGGG - Intergenic
1095620519 12:44248438-44248460 CTCTTGAGCTGGAGATCTTGAGG - Intronic
1097076156 12:56396361-56396383 CTCAGGAGCTCGAGACCAGACGG + Intergenic
1097647616 12:62255768-62255790 CTCTTGAACTTGAGAGGCGAAGG + Intronic
1098029839 12:66242398-66242420 ATCTAGAGCTGGAGAGAAGTCGG + Intronic
1098079169 12:66765734-66765756 CTCTTGAGAAGGAAAGCTGAAGG + Intronic
1099783995 12:87237192-87237214 GTCCTGATCAGGAGAGCAGAGGG - Intergenic
1100557602 12:95711603-95711625 CTGTTGAACTGGTGAGTAGAAGG + Intronic
1101895973 12:108757073-108757095 CACTTGAACTGGAGAGATGAAGG + Intergenic
1101899947 12:108784333-108784355 CTCTTTAGCTGAAGAGGACAGGG + Exonic
1102067092 12:109986073-109986095 CTCTTGAACTGGGGAGACGAAGG - Intronic
1102876398 12:116452544-116452566 CTCTTGAGCTAGGGAGGCGAAGG - Intergenic
1103082741 12:118038287-118038309 CTCTGCAGCTGGAGAGAAGTCGG - Exonic
1103499734 12:121392079-121392101 CTCTGCAGCTGGAGAACAGATGG - Intronic
1103588653 12:121974733-121974755 ACCTTGAGTTAGAGAGCAGAGGG + Intronic
1103675026 12:122649186-122649208 CTCTTGAGCTTGAGAGGTCAAGG - Intergenic
1103717547 12:122954083-122954105 CACTTGAGCTGGAGAGGTCAAGG + Intronic
1104185195 12:126423798-126423820 CTCTGGCCCTGGAGAGCAGTGGG + Intergenic
1107037283 13:35914630-35914652 CCCTTGAGCTGGAGAGGTCAGGG + Intronic
1107937873 13:45360612-45360634 CTCTCGAGCAGGAGAGGTGAGGG - Intergenic
1108543497 13:51467117-51467139 CTCTGGAGCAGGAGAGGACAGGG + Intergenic
1109842458 13:67937270-67937292 CTCAGGAGCTGGAGACCAGCTGG + Intergenic
1109861360 13:68202931-68202953 CTCTTGAACTCGAGAGGAGGAGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1112127255 13:96481662-96481684 TCCCTGAGCTGGAGAGCGGAGGG - Intronic
1112972186 13:105273911-105273933 CTATGGGGCTGAAGAGCAGATGG - Intergenic
1114204777 14:20558643-20558665 ATCTTGATCTGGAGAGAACATGG + Exonic
1114313991 14:21493078-21493100 CTCTTGATCTGCAGAGGAGGAGG - Exonic
1116012501 14:39367334-39367356 CTGTTGAGCCCTAGAGCAGAAGG + Intronic
1116962186 14:50977912-50977934 CTCTTGGGCTGGAGAAGACAGGG - Intronic
1116973530 14:51093544-51093566 CTCTCGAGCTGGAGAGAACGCGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121095613 14:91216162-91216184 CTCTTGAGGTGGAGAGCAGGAGG + Intronic
1121287007 14:92743767-92743789 CTCCTAAGCTGGGCAGCAGAGGG + Intronic
1122882940 14:104698146-104698168 CTTTCCAGATGGAGAGCAGAGGG + Intronic
1123508540 15:20971581-20971603 CTCTAAAACTGGAGAGGAGAGGG - Intergenic
1123565762 15:21545330-21545352 CTCTAAAACTGGAGAGGAGAGGG - Intergenic
1124032159 15:26021399-26021421 CTCTGGAGCAGCACAGCAGAAGG + Intergenic
1125398622 15:39276371-39276393 CCCTTGAGCTGGAGAGATGATGG - Intergenic
1126000773 15:44207454-44207476 CACTTGAGCTGGGGAGCTCAAGG + Intergenic
1126829484 15:52586127-52586149 CTCATGAGCTGCATAGCCGAAGG + Intronic
1128349839 15:66881445-66881467 GGCATGAGCAGGAGAGCAGAAGG + Intergenic
1128377507 15:67088061-67088083 ACCTTGAGCTGGAGCGGAGAGGG + Intronic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1130036654 15:80367259-80367281 CCCTTGGTCTGGAGAGCACATGG + Intronic
1130297998 15:82660615-82660637 CTGGTGTGCAGGAGAGCAGACGG - Intronic
1130560114 15:84951383-84951405 CACCTGAGCTGGAGTGCAGTGGG - Intergenic
1131194048 15:90340838-90340860 CTCTTGAGCTCGGGAGTTGAAGG + Intergenic
1131536259 15:93240286-93240308 CTTCTGGGCTGGAGAGGAGAGGG + Intergenic
1131575298 15:93583812-93583834 ATCTGGAGCTGGCGAGCAGCTGG - Intergenic
1131807474 15:96137552-96137574 CTATTGTGCTGGAGTGCAGGAGG + Intergenic
1132050068 15:98600259-98600281 TTCTTGAGCTGGAGAGAATTGGG + Intergenic
1134801052 16:17085132-17085154 TTCTTGTGCTGAAAAGCAGAAGG + Intergenic
1135071281 16:19354047-19354069 CTCTTAACCTGGAGAGAGGAAGG - Intergenic
1136005286 16:27325019-27325041 CTCTTAAGCAGGAGAGGAGCGGG - Intronic
1136250024 16:28998354-28998376 CTCTTGAGCCTGAGAGTTGAAGG + Intergenic
1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG + Intergenic
1136661578 16:31767762-31767784 CTCTGGAGCCTGAGAGCAAAGGG - Intronic
1138529532 16:57627607-57627629 CTCTGGAGCTGGAATGCAGACGG + Intronic
1138542875 16:57699058-57699080 GCCTGGGGCTGGAGAGCAGAGGG + Intronic
1140953354 16:79839847-79839869 ATCATGAGCTTCAGAGCAGACGG + Intergenic
1141125875 16:81400805-81400827 CTCTTGAGCTCGAGAGGTCAAGG - Intergenic
1141659672 16:85435262-85435284 CTCTAGAGCTGGGGAGAAGGAGG - Intergenic
1142075543 16:88115611-88115633 CTCTAGTTCTGGAGACCAGAAGG + Intronic
1142324110 16:89402964-89402986 CTCTAGAGCTGGAGCCCAGGCGG - Intronic
1142595930 17:1030044-1030066 CTATTGAGCTGCTGAGCAGTTGG - Intronic
1143386703 17:6535221-6535243 AGCCTGGGCTGGAGAGCAGAGGG + Intronic
1144213819 17:13037157-13037179 CACTGGAGATGAAGAGCAGATGG + Intergenic
1144264792 17:13557711-13557733 CTCTGCAGCTTGAGAGGAGATGG - Intronic
1144472606 17:15558183-15558205 CTGTTGGGATCGAGAGCAGAAGG - Intronic
1144923875 17:18786508-18786530 CTGTTGGGATCGAGAGCAGAAGG + Intronic
1145293081 17:21565272-21565294 CTCTGGAGCTGGTGCTCAGATGG - Intronic
1145386888 17:22420654-22420676 CTCTGGAGCTGGTGCTCAGATGG + Intergenic
1145837630 17:27966665-27966687 CTCTTGAGCTGGGGAGGTGGAGG - Intergenic
1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG + Intronic
1149356208 17:55842320-55842342 CTCTTGAACTTCAGAGCAAATGG + Intronic
1149415452 17:56455156-56455178 CTCAGTAGCTGGAAAGCAGATGG - Intronic
1149761912 17:59239815-59239837 CGCTTGAGCTGGAGAGGGGGAGG - Intronic
1149830783 17:59869967-59869989 TTTTGGAGCTGGAGAGCAAATGG + Intronic
1151393664 17:73804666-73804688 CTCTTAAGCGGCAGAGCAGGAGG + Intergenic
1151713894 17:75821793-75821815 CTGTTGAGCGAGTGAGCAGAGGG + Intronic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1153370485 18:4309898-4309920 CTCTAGAGGTGGAGAAGAGATGG - Intronic
1154338425 18:13483927-13483949 GTCTTGAGCTGTGAAGCAGATGG - Intronic
1154382955 18:13869106-13869128 GTTTTCAGCTGGAGAGCAGACGG + Intergenic
1154437854 18:14360691-14360713 CTCTGGGGGCGGAGAGCAGAGGG - Intergenic
1155786934 18:29913692-29913714 CTCCTGAGATGGCCAGCAGAAGG - Intergenic
1155884923 18:31196128-31196150 CACTTGAGCTGGAGAGGTGGAGG + Intergenic
1156311939 18:35931690-35931712 CGCTTGAGCTTGAGAGGTGAAGG + Intergenic
1157661369 18:49447926-49447948 CCCTTGGTCTGGAGAGCACATGG + Intronic
1157891709 18:51424243-51424265 CTCTAGAGCTGGAGACAAGGTGG + Intergenic
1158018403 18:52810917-52810939 CTCTTGAGAGGGATGGCAGATGG + Intronic
1158623154 18:59049830-59049852 CCCTTCAGAAGGAGAGCAGAAGG - Intergenic
1159467152 18:68798300-68798322 CTGTAGAGCTGGGAAGCAGAAGG + Intronic
1160042657 18:75359861-75359883 CTTTTGAGCTGGGGAACAGCAGG + Intergenic
1160835061 19:1120930-1120952 CGCCTGGGCTGGAGAGCAGTGGG + Intronic
1161007068 19:1942037-1942059 CTCTTGAGGGGGAGAGCAGGGGG + Intronic
1161094346 19:2380681-2380703 CTCATGAGATGCTGAGCAGAAGG + Intergenic
1161340279 19:3738061-3738083 GTCATGACCCGGAGAGCAGATGG + Intronic
1162003983 19:7765423-7765445 CTCTAGAGCAGGACAGGAGAGGG + Intronic
1166224383 19:41386046-41386068 AGCTAGAGCAGGAGAGCAGATGG - Intronic
1167720097 19:51173474-51173496 CTGTTGTTCTGAAGAGCAGAAGG + Intergenic
1168340683 19:55621588-55621610 CGCTAGTGATGGAGAGCAGAGGG - Exonic
1168713100 19:58512850-58512872 CTATTGTGCTGAAGAGGAGAGGG + Intergenic
925472312 2:4175657-4175679 CCCTTAATCTGGAGAGCACATGG - Intergenic
925483248 2:4300134-4300156 CTCTTCATCTGGAGGGCAGAAGG + Intergenic
925754428 2:7120179-7120201 GCCTGGAGCTGGAGACCAGATGG + Intergenic
927562427 2:24083516-24083538 CTCAGAAGCTGTAGAGCAGAGGG + Intronic
928083366 2:28329189-28329211 TTCCTGAGCTAGAGGGCAGAGGG + Intronic
928672772 2:33619411-33619433 GTCTGGATCTGGAGAGCTGATGG + Intergenic
928889131 2:36181547-36181569 TTCTTGTGGTGGGGAGCAGAGGG - Intergenic
930822295 2:55658664-55658686 GTCATGAGCTGGAGAGCACATGG - Intronic
930968231 2:57358919-57358941 CTCTTGCACCGTAGAGCAGAGGG - Intergenic
932891734 2:75602800-75602822 CTGTACAGCTGGAGAACAGAGGG + Intergenic
933822658 2:86128340-86128362 AACTTGAGCTGGAGGGGAGAGGG + Intronic
935830689 2:106998104-106998126 CTCGGGAGGTGGAGGGCAGAAGG + Intergenic
936238458 2:110766913-110766935 CTCTTGTCTTGCAGAGCAGATGG - Intronic
938035035 2:128028167-128028189 GTCGTGAGCGGGAGAGCGGACGG + Intergenic
938165591 2:129022954-129022976 CTCTTGAGCTGAAGAGTTGAAGG - Intergenic
938821509 2:134964878-134964900 TTCAGGAGCTGGAGAGCAGAAGG + Exonic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
940990206 2:160088573-160088595 CCCTTGGTCTGGAGAGCACATGG - Intergenic
941386573 2:164859589-164859611 CTCCTGAGTTCTAGAGCAGAAGG - Intergenic
942456423 2:176141190-176141212 CTCTTGAGCTGCAGAGCAAATGG - Intergenic
942814794 2:180039829-180039851 GCCTTGGGCTGGAGAGCAGATGG - Intergenic
943984641 2:194603906-194603928 CCCTTGGTCTGGAGAGCATATGG + Intergenic
946375234 2:219303912-219303934 CCCATGAGCTGCAGGGCAGAGGG - Intronic
946640172 2:221775411-221775433 CGTTTGTGCTGGAGAGCAGGTGG - Intergenic
947150283 2:227108547-227108569 CTCTTGCTCTGAGGAGCAGATGG - Intronic
947643593 2:231721759-231721781 ACTTTGACCTGGAGAGCAGATGG - Intergenic
949035872 2:241815527-241815549 CTCTTTATCTGCAGAGGAGAAGG + Intronic
1169213848 20:3782810-3782832 CCCTGGAGTTGGAGACCAGAAGG - Intergenic
1169909291 20:10634325-10634347 CTCTTCAGGTGCAGAACAGAGGG + Intronic
1170539216 20:17371132-17371154 CCATTGGGCTGGAGAGCTGAGGG + Intronic
1171400967 20:24872820-24872842 CTTTAGAGCTGGTGAGCAGCTGG + Intergenic
1171823613 20:29876186-29876208 CTCTGGAGCTGGAGAGCCGGGGG + Intergenic
1172238880 20:33398408-33398430 CTCTTGAGCTCAGGAGGAGAAGG + Intronic
1172500520 20:35423061-35423083 CTCTTGAACCTGAGAGAAGAAGG + Intergenic
1173281825 20:41635222-41635244 CTCCTGAGCAGCAGGGCAGAGGG + Intergenic
1173862352 20:46292309-46292331 CAGCTCAGCTGGAGAGCAGAGGG - Intronic
1174230266 20:49040558-49040580 CTGATGTGCTGGAGAGCAGATGG + Intergenic
1174436539 20:50510812-50510834 CACCCGAGCTGGAGAACAGAAGG - Intronic
1175428173 20:58883672-58883694 CTGCTGAGTGGGAGAGCAGAGGG + Intronic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1179220990 21:39407318-39407340 TTCTAGAGCTGGTGAGAAGATGG + Intronic
1179337397 21:40470635-40470657 CTCTTGAGCTGGGGAGGTCAAGG - Intronic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1179996695 21:44977510-44977532 CTCTGGGGGCGGAGAGCAGAGGG + Intergenic
1180994335 22:19957793-19957815 CTCATGAGCTTGCGAGCCGATGG + Intronic
1181097125 22:20513110-20513132 CACTTGGGCTGGAGTGCAGTTGG + Intronic
1181446134 22:22976320-22976342 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1181446141 22:22976363-22976385 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1181933146 22:26418954-26418976 CACTGGAGCTGGAGAGCAAGAGG + Intergenic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1182669048 22:31980601-31980623 CCCTTTAGCAGGAGAGCAGTGGG + Intergenic
1184778459 22:46634997-46635019 CTTTTGAACTAGAGAGCAGCGGG + Intronic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950423243 3:12910892-12910914 CTCCTGGGCTGGGGAGCAGGGGG - Intronic
950442439 3:13018022-13018044 GTCCAGAGCTGGGGAGCAGATGG + Intronic
950764934 3:15266604-15266626 CTCCCCAGCTGGAGAGCAGCAGG + Intronic
950853802 3:16087023-16087045 CTCTTGGGCTGGTAAGCAAAGGG + Intergenic
952254303 3:31682278-31682300 CTTTTGAGCTGGAGAGTACCAGG - Intronic
954397092 3:50298681-50298703 CTCTGGAGCAGGTGAGTAGAAGG - Intronic
954862752 3:53704075-53704097 CCCTTCAGCTGGAGCACAGAGGG + Intronic
955245524 3:57221235-57221257 CGCTTGAGCTGGAGAGTTGGAGG - Intronic
958894112 3:99811147-99811169 AACTTGAGCTGGTGAACAGAAGG - Intergenic
959276131 3:104279249-104279271 CCCTTGGCCTGGAGAGCACATGG - Intergenic
959964438 3:112337138-112337160 CTCTCAAACTGGAAAGCAGATGG + Intronic
960373900 3:116874834-116874856 CTCTTGAGCTGGATGAGAGATGG - Intronic
961815164 3:129546238-129546260 CACTTGAGCTGGAGAGGTCAAGG + Intronic
962176785 3:133163505-133163527 CTATTGTGGTGGACAGCAGAGGG + Intronic
963174028 3:142280099-142280121 CCCTTGATCTGGAAAGCACATGG + Intergenic
963174034 3:142280142-142280164 CCCTTGAGCTGGAGAGCACGTGG + Intergenic
963246356 3:143067385-143067407 CTCTTGAGCTGGAATGCTGTGGG + Intergenic
964180155 3:153874022-153874044 CTCTGGAGATAGAGAACAGAAGG + Intergenic
965203864 3:165695621-165695643 TTCTTGAGCTGCAGAGAACATGG + Intergenic
966201015 3:177359674-177359696 CTCTTAGGCTGCAGAGCCGAGGG - Intergenic
966728539 3:183130971-183130993 CTTTCCAGGTGGAGAGCAGAGGG - Intronic
968268674 3:197382614-197382636 CTGTTGGGCAGCAGAGCAGAGGG + Intergenic
968292676 3:197550793-197550815 TTCTGGAGCTGGGGGGCAGATGG - Intronic
969241882 4:5904320-5904342 CTCTTTAACTGCAGAGCAAAAGG + Intronic
969921108 4:10540544-10540566 CCCCTGAGCCGGAGAGCAGCAGG - Exonic
970083227 4:12314413-12314435 CTCTGGAGCTGGGAAGTAGATGG + Intergenic
970522346 4:16898658-16898680 CTCTATAGCAGGAGAGGAGAGGG + Exonic
971374147 4:26043027-26043049 CACTTGAGCTGGAGAGGTGGAGG - Intergenic
971521487 4:27557189-27557211 CTCCTGAGGTAGAGAGCAGGTGG - Intergenic
972067660 4:34971121-34971143 TACTTGACCTGGAGAGGAGAAGG - Intergenic
973986077 4:56355281-56355303 CTCAGAAGCTGGAGAGGAGAAGG - Exonic
974082851 4:57230774-57230796 CTCTTTATCTGTAAAGCAGAAGG + Intergenic
974092641 4:57328011-57328033 CTCTTGAACTCGGGAGCTGAAGG + Intergenic
975273946 4:72473259-72473281 CTCTAAAGGTGGAGAGAAGAAGG + Intronic
975411887 4:74062481-74062503 CTCTTCAGCTTTAGAGCCGATGG + Intergenic
977768898 4:100833323-100833345 CCTTTCAGCTGGAGAGCTGAAGG - Intronic
978019087 4:103786202-103786224 CCCTTGGTCTGGAGAGCATATGG + Intergenic
979511724 4:121561871-121561893 ACCTTGAGCAGGAGAGCAGCAGG - Intergenic
979609227 4:122671679-122671701 CTCTTTAGCTGGAGAAATGATGG - Intergenic
979984156 4:127294576-127294598 CTGTTGAGCTGGATAGGAGGTGG + Intergenic
980466956 4:133199202-133199224 CACTTGAGCTGGAGAGGTGGCGG + Intronic
980642272 4:135596229-135596251 CTCTTGGTCTGGAGAGCACATGG + Intergenic
982910807 4:161140520-161140542 CTCTTGAACTTGAGAGGAGGAGG - Intergenic
982980818 4:162132756-162132778 AGCTTCACCTGGAGAGCAGATGG - Intronic
983300076 4:165913930-165913952 CTCTTGAGCTGGAGAGGTCTAGG + Intronic
983612830 4:169668951-169668973 TTCTTTAGCTGGGGAGGAGAAGG + Intronic
983998908 4:174217428-174217450 CTCTGGAGCTGTAGAGCACCAGG - Intergenic
985655236 5:1128274-1128296 CTCTTGTGCTGCAGATCAGCGGG - Intergenic
985691358 5:1314504-1314526 CTCTCGAGGTGGAGAGCACGAGG + Intergenic
985773046 5:1825009-1825031 CCCTTGTGCTGGTGGGCAGAAGG + Intergenic
986254777 5:6093081-6093103 CGCTTTAGGTAGAGAGCAGAAGG + Intergenic
986609381 5:9551517-9551539 CTCTTGAACTGGGGAGGAGGAGG + Intergenic
987202325 5:15589903-15589925 TTCATGAGCTGCAGAGCAGATGG - Intronic
987384763 5:17318692-17318714 CTCTTGATCTTCAGAGCAGAAGG + Intergenic
987630938 5:20470843-20470865 TTCTTGAGCAGGAAAGCAGCAGG - Intronic
989373599 5:40735649-40735671 TTGTTGATCTGGAGAGCAAAAGG + Intronic
990704327 5:58511121-58511143 CTGGTTAGCTGGAGATCAGAGGG + Intergenic
992755090 5:79896652-79896674 TTCAGGAGCTAGAGAGCAGAAGG - Intergenic
993875376 5:93300333-93300355 TTTTTGAGATGGAGAGCAAAAGG - Intergenic
994379599 5:99055936-99055958 CTCTTGATCTGCATGGCAGAAGG + Intergenic
995581410 5:113606685-113606707 CCCTTGGGCTGGAGGGCACATGG + Intergenic
995931980 5:117456421-117456443 CTCTTGAGATGCAGAGTAAAGGG - Intergenic
996477434 5:123937400-123937422 CCCTTGGTCTGGAGAGCACATGG - Intergenic
998463616 5:142326154-142326176 CTCTTGAGCCGCAGAGGAAATGG + Intronic
999685108 5:154095814-154095836 ATCTTGAGCTGGAGAGGAAGGGG - Intronic
1000100652 5:158013235-158013257 CTCTTGAGGGAGAGACCAGAAGG - Intergenic
1001137247 5:169112737-169112759 GTCATGAGCAGGAGATCAGAGGG + Intronic
1001663050 5:173411025-173411047 CTCTGGAGCTGGAGGGCGGCTGG - Intergenic
1002165549 5:177342600-177342622 CACTTGAGCTGGAGAGGTCAAGG + Intronic
1002197675 5:177510038-177510060 CTCGTGAGGTGGAGAGGAGCAGG - Intronic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002430923 5:179203342-179203364 GTCTGGAGCTGTAGAGCAGGTGG - Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003158783 6:3618222-3618244 CTCTTTTGCAGGAGTGCAGACGG + Intergenic
1004947412 6:20630775-20630797 GTCTTAAGCTGGAAACCAGAAGG - Intronic
1005375733 6:25180469-25180491 CTCTAGAGCTGGAGGTGAGAAGG - Intergenic
1006353111 6:33535797-33535819 CTCTTGTCCTGGAAAGAAGATGG + Intergenic
1007171222 6:39864917-39864939 CACCTGAGCTGTAGTGCAGAGGG + Intronic
1007510504 6:42371040-42371062 CTCTTTAGATGGAGTGCAAACGG + Intronic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1010574330 6:77512801-77512823 CCCTTGGTCTGGAGAGCACATGG - Intergenic
1012474555 6:99605288-99605310 GTCTTGAGTGGGAGAGCACAGGG + Intergenic
1012914431 6:105154448-105154470 CTCTTCAACAGGGGAGCAGAAGG - Intergenic
1014198042 6:118580929-118580951 CCCTTGGTCTGGAGAGCACACGG + Intronic
1015194018 6:130505570-130505592 CTCATGAGATAGAGAGTAGACGG + Intergenic
1016551985 6:145291880-145291902 ATCGTGAACTGGAGAGCAGGGGG + Intergenic
1017068172 6:150549234-150549256 CTCTTAAGCTACAGAGCAGATGG + Intergenic
1018555780 6:165049471-165049493 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1018555784 6:165049512-165049534 CTCTTGGTCTGAAGAGCACATGG + Intergenic
1018881355 6:167884852-167884874 CTCTCTAGCTAGAGAGGAGAAGG - Intronic
1019711606 7:2520500-2520522 CTCTGGAGCTGGACAGGAGGCGG - Intronic
1019734465 7:2644013-2644035 CTCTGCAAGTGGAGAGCAGAGGG + Intronic
1020161013 7:5771711-5771733 CTCTTGAGCTCGAGAGGTGGAGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1023009556 7:35913672-35913694 CGCTTGAGCTGAAGAGGTGAAGG - Intergenic
1024339596 7:48243634-48243656 TTCTCTAGCTGGAGAGCTGATGG - Intronic
1024875136 7:54013570-54013592 CAGGTGAGCAGGAGAGCAGATGG + Intergenic
1025123234 7:56323944-56323966 CACTTGAGCTGAAGAGGTGAAGG - Intergenic
1027357711 7:77375462-77375484 GTCTTTAGAAGGAGAGCAGAGGG + Intronic
1028121435 7:87059758-87059780 CGCTGGAGCTGGGGAGCAGGTGG + Intergenic
1028351651 7:89857197-89857219 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1028351657 7:89857240-89857262 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1028351671 7:89857326-89857348 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1028408917 7:90506681-90506703 GGCTTGAGCTGGAGAGATGAAGG + Intronic
1028855734 7:95590976-95590998 CACTTGGGCTGGAGTGCAGTGGG + Intronic
1029610266 7:101622876-101622898 CTCCTGTGCTGGGGAGCACAGGG - Intronic
1030180319 7:106700726-106700748 CTCTTGAGCTTGGGAGGATAAGG + Intergenic
1030462346 7:109855028-109855050 CTCTTGTGATTGAGAACAGATGG + Intergenic
1031492662 7:122408463-122408485 CACTTGGGCTGGAGTGCAGTGGG + Intronic
1032193411 7:129777103-129777125 CCTTAGAGCTGGAGAACAGATGG + Intergenic
1033344492 7:140516952-140516974 CGCTTGAACTGGGGAGGAGAAGG - Intergenic
1033837378 7:145331721-145331743 CTCCTGAACAGGAGAGCAGCTGG + Intergenic
1034234751 7:149557885-149557907 CTGGTGAGCTGCAGAGCTGAGGG + Intergenic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1037774026 8:21820859-21820881 TTCCTGAGCTAAAGAGCAGATGG + Intergenic
1037905049 8:22711316-22711338 CTCGTTAGCTGGAAGGCAGAGGG - Intergenic
1037986294 8:23292701-23292723 CTCCTGAGCAGGAGAGCCGAAGG + Intronic
1038385485 8:27140522-27140544 CTCTTCAACTGGAAAGCCGAAGG + Intergenic
1038546155 8:28427090-28427112 CCCTTAGGCTGGAGAGCAAAGGG - Intronic
1038971298 8:32638808-32638830 CCCTTGAGCTGAAAAGCAGCAGG + Intronic
1039183413 8:34891293-34891315 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1039304898 8:36250809-36250831 CTCCTGAGCTGCACAGCACAGGG + Intergenic
1039834870 8:41248164-41248186 CTCTCCAGCTGGAGTGCAGGTGG - Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1040526030 8:48226014-48226036 CCCTTGATCTGGAGAGCACATGG + Intergenic
1040769537 8:50956593-50956615 CACCTGAGCTGGAGTGCAGTGGG + Intergenic
1042341479 8:67684570-67684592 ATCTTGAGCTGGAGAGAGGCCGG - Intronic
1046776832 8:118173321-118173343 TTATGGAGGTGGAGAGCAGAAGG + Intergenic
1046920613 8:119724146-119724168 CCCTTGAGCTGGAGAGGTCAAGG + Intergenic
1048052161 8:130828407-130828429 CCCTTGGTCTGGAGAGCACATGG + Intronic
1050306576 9:4311323-4311345 CACTTGAGCTGGAGAGGTGGAGG + Intronic
1051510152 9:17868532-17868554 GACATGAGCTGGAGAGGAGAAGG - Intergenic
1052215804 9:25964463-25964485 CTCTTGGTCTGGAGAGCACATGG - Intergenic
1053083122 9:35194064-35194086 CCCTTGGTCTGGAGAGCAAACGG - Intronic
1053418825 9:37964000-37964022 CTCTTGAACTAGAGGGAAGAAGG - Intronic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1056971492 9:91208594-91208616 CTCCTGAGGTGGGGAGCAGGTGG + Intergenic
1059837958 9:118178332-118178354 CCCTTGACATGGGGAGCAGATGG + Intergenic
1061270684 9:129539895-129539917 CCCTTGAGCTGGAGAGATCAAGG + Intergenic
1061309431 9:129752687-129752709 CTCTTAAGCCAGAGAGGAGAAGG + Intronic
1061417667 9:130455943-130455965 CCCGAGTGCTGGAGAGCAGAGGG + Intronic
1061855338 9:133438959-133438981 TTCTTGAGCAGGAGAGAAGAGGG - Intronic
1186672361 X:11780645-11780667 CACTTGAGCTGGGGAGATGATGG - Intergenic
1186776552 X:12870629-12870651 CTCATGAGCTGTACAGCAGGTGG - Intronic
1187508080 X:19893348-19893370 CTCTTGAGCTTGAGCTCAGGAGG - Intergenic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1190503052 X:51098043-51098065 ATATTGACCTGCAGAGCAGAAGG + Intergenic
1191608196 X:63083914-63083936 CTCTTCAGCTGGAGACTAGAGGG + Intergenic
1192580818 X:72279449-72279471 CTCTCTAGCTGGAAAGCACATGG - Intronic
1193790777 X:85813167-85813189 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1194718376 X:97312431-97312453 CTCTTGAACTGGGGAGGAGGAGG - Intronic
1194944388 X:100050278-100050300 CTCCTAAGCTGGAGTGCAGTGGG - Intergenic
1196439283 X:115703642-115703664 CTCTTGGGCAGGTGAGCAAAGGG - Intergenic
1196521356 X:116676416-116676438 GTGTTGTGTTGGAGAGCAGAGGG + Intergenic
1196851307 X:119941707-119941729 CACTTGAGCTGGAGAGGTCAAGG - Intronic
1197356190 X:125439423-125439445 CTCTTGGTCTGGAGAGCATATGG - Intergenic
1197792752 X:130271804-130271826 CTCTTAGGCTGGAGTGCAGTGGG + Intergenic
1198263306 X:134985999-134986021 CTCTGTACCTGGAGAGCAGAGGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1200088521 X:153623628-153623650 CTCTGGCTCTGGAGAGCTGAGGG - Intergenic