ID: 1077230764

View in Genome Browser
Species Human (GRCh38)
Location 11:1457328-1457350
Sequence CCCAGGGTCATGCCTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077230757_1077230764 30 Left 1077230757 11:1457275-1457297 CCGCGGGCTGCCTGACGGGCTGT 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1077230764 11:1457328-1457350 CCCAGGGTCATGCCTCCAGCAGG 0: 1
1: 1
2: 0
3: 23
4: 260
1077230758_1077230764 20 Left 1077230758 11:1457285-1457307 CCTGACGGGCTGTGACTTCTCAT 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1077230764 11:1457328-1457350 CCCAGGGTCATGCCTCCAGCAGG 0: 1
1: 1
2: 0
3: 23
4: 260
1077230760_1077230764 -7 Left 1077230760 11:1457312-1457334 CCATACTTCCTGACAGCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 283
Right 1077230764 11:1457328-1457350 CCCAGGGTCATGCCTCCAGCAGG 0: 1
1: 1
2: 0
3: 23
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077230764 Original CRISPR CCCAGGGTCATGCCTCCAGC AGG Intronic
900179867 1:1306359-1306381 GCCAGGGTCCAGCCCCCAGCAGG + Intronic
900308591 1:2022805-2022827 CCCTGGATGCTGCCTCCAGCTGG + Intronic
900339963 1:2183632-2183654 TCCAGGGTCATGGTGCCAGCAGG + Intronic
900989458 1:6091616-6091638 TCCAGGGTCAAGGCTCCAGGTGG - Intronic
901655194 1:10765207-10765229 CCCAGTGTCTTCCCTCCTGCAGG - Intronic
901668266 1:10838665-10838687 CCCAGGGTAATGCCTCCCTCAGG - Intergenic
902125805 1:14209984-14210006 CCCAGATTCATTCCTTCAGCAGG + Intergenic
902436070 1:16398742-16398764 CCTAGAGTCAGGCCTCCAGAGGG + Exonic
903035008 1:20487201-20487223 CCCAAGGTCATGCCAGCTGCTGG + Intergenic
904163148 1:28536040-28536062 CACTGGGTCATGCCTGAAGCTGG - Intronic
904423860 1:30410789-30410811 CCCGGGGTCACACATCCAGCAGG - Intergenic
904751010 1:32741621-32741643 CCCGGGGTCGTGCCCCCCGCTGG - Intergenic
904787048 1:32991028-32991050 CACTGGGTCATGCCTTCTGCTGG - Intergenic
905302227 1:36993206-36993228 CCCAGCCTCCTGACTCCAGCTGG - Intronic
905646125 1:39626178-39626200 CCAAGGTTCATGCCTGCTGCTGG + Exonic
905877194 1:41439815-41439837 CACAAGGTCTTGCTTCCAGCTGG - Intergenic
906535986 1:46551225-46551247 CCCGGGGCACTGCCTCCAGCCGG + Intronic
906965776 1:50455046-50455068 CCCAGCCTCATTCCTACAGCAGG + Intronic
907515887 1:54993258-54993280 CCCAGGGTCACACTGCCAGCAGG + Intergenic
908251723 1:62271227-62271249 CCCAGGGCCAGGACTCCAGGTGG - Intronic
908319736 1:62967638-62967660 CCCGGGGTCATCTCTGCAGCAGG + Intergenic
910664263 1:89707454-89707476 CCCAGTCTAATGCCCCCAGCAGG + Intronic
910832327 1:91473494-91473516 TCCAGGGTCTTGCCACCTGCAGG - Intergenic
911329908 1:96515067-96515089 TCCAGGGTCATGCAGCCAGCAGG + Intergenic
912569710 1:110612557-110612579 CCCTGGTTCAAGCCACCAGCAGG + Intronic
914755281 1:150558751-150558773 CCCAGGGTCAGGCATATAGCAGG - Intronic
915253506 1:154608035-154608057 GCCAGGGTCGTGCCGCCGGCGGG - Exonic
918584667 1:186172292-186172314 CCCAGGGTCATGGCTGTACCCGG + Intronic
918727342 1:187942322-187942344 CACAAGGTCCTGCCTCCTGCTGG - Intergenic
920027169 1:203007454-203007476 CCCCGGGCCATGTCTCCGGCCGG - Exonic
922421429 1:225463300-225463322 CCCAGATCCACGCCTCCAGCTGG - Intergenic
924045997 1:240031195-240031217 CCCAGGGTCGTGCTTAAAGCTGG - Intronic
1062825578 10:565959-565981 TCCAAGGTGCTGCCTCCAGCAGG - Intronic
1065102032 10:22340795-22340817 TCCCGGGCCAGGCCTCCAGCTGG - Intergenic
1067044217 10:42975300-42975322 CCCAGGGTGATGCTGCCTGCAGG - Intergenic
1067230064 10:44399834-44399856 CCCAGGGGCATGCCTCAGGCAGG - Intergenic
1067508212 10:46874252-46874274 CCCAGGGCCAGGCCTCCATCAGG + Intergenic
1067654039 10:48177593-48177615 CCCAGGGCCAGGCCTCCATCAGG - Intronic
1067740951 10:48895866-48895888 AACAGAGGCATGCCTCCAGCAGG - Intronic
1067793652 10:49305654-49305676 CCCATGGACCTGCCACCAGCGGG + Intronic
1069940770 10:71953838-71953860 GCCTGGGTTATGACTCCAGCTGG - Intergenic
1070823840 10:79379686-79379708 CCCAGGCTCAGGCTACCAGCCGG - Intergenic
1070967118 10:80536457-80536479 CCCAGGGTCTGGGCTCCTGCGGG - Intergenic
1071569234 10:86687373-86687395 CCAAGGGCCATGCCTCCAGGAGG - Intronic
1072609137 10:97004962-97004984 CCCAAGGCCATTCCTCCAGGGGG + Intronic
1073072826 10:100805688-100805710 CCCAGGCTCAAGCCTCCTACAGG - Intronic
1075424529 10:122331213-122331235 CCCAGAGTCATGGCTCGACCAGG + Exonic
1075674883 10:124289522-124289544 CTCAGGGTCAGTCCTCCTGCCGG + Intergenic
1076055323 10:127367933-127367955 CCCAGGGGCATGGCTGCAGTGGG - Intronic
1076097581 10:127744546-127744568 CCCAGGGCCAGGCCTACTGCTGG + Intergenic
1076359401 10:129876483-129876505 CCCACAGTCATGTCTGCAGCTGG - Intronic
1077230764 11:1457328-1457350 CCCAGGGTCATGCCTCCAGCAGG + Intronic
1077422631 11:2460180-2460202 CCCGGAGTCCTGCCCCCAGCTGG - Intronic
1077466940 11:2737974-2737996 CCCAGGGCCCTGCCTGGAGCAGG - Intronic
1078338003 11:10478792-10478814 CACAGGGTCGTGCCTCCCTCTGG + Intronic
1081710968 11:45215131-45215153 GGGAGGGTCATGCCTCCAGGTGG - Intronic
1082810028 11:57474167-57474189 TCCTGGCTCAGGCCTCCAGCTGG - Intronic
1083184041 11:61007375-61007397 CACAGGGTCAGGCCTCAAGGTGG + Intronic
1083951908 11:65961317-65961339 CCTAGGGTCGTGGCTCCAACGGG - Intergenic
1084323288 11:68385304-68385326 CCCAGGGCCAAGCCTGCTGCTGG - Intronic
1084491349 11:69480275-69480297 CTCAGGGTCAGGCCTGCAGAAGG - Intergenic
1084547194 11:69820343-69820365 CCCAGGGTCCTGGGGCCAGCAGG + Intergenic
1085350687 11:75796309-75796331 CCCAAGGTCATCCTTGCAGCTGG + Exonic
1085407952 11:76275281-76275303 CCCACTGTTATGCCTCCGGCTGG + Intergenic
1088469439 11:110177467-110177489 CCAAGGTGCAGGCCTCCAGCTGG - Intronic
1089768569 11:120786154-120786176 CCCAAGGCCATGGCACCAGCGGG - Intronic
1091794111 12:3287587-3287609 CCCAGGGACATCACTCCAGCTGG - Intergenic
1093911038 12:24747698-24747720 CCCATTGTCCTGCCTCCACCTGG - Intergenic
1095121975 12:38430204-38430226 CCCAGGGTGATTCCTCCTGCAGG - Intergenic
1096686308 12:53290496-53290518 CCCCGGGTCATTCCTAGAGCAGG - Intronic
1102347389 12:112168706-112168728 CCCAAGGTCATGCAGCCAGCTGG - Intronic
1102697946 12:114814807-114814829 CTCAGGCTCCTGCCTCCAACAGG - Intergenic
1102788530 12:115624040-115624062 CCCAGGGGGCTGCCTCCAGAAGG + Intergenic
1104965815 12:132508404-132508426 CCCAGGGCCATGCCAGCACCTGG + Intronic
1105673040 13:22642119-22642141 TCCAGGGGCAGGCCCCCAGCTGG + Intergenic
1110553600 13:76833649-76833671 CCATGGGTCATGTCTACAGCCGG + Intergenic
1112381800 13:98897910-98897932 CCCAACCACATGCCTCCAGCTGG - Intronic
1113299516 13:109002216-109002238 CCCAGGGCTCTGCCTTCAGCTGG + Intronic
1114815945 14:25958271-25958293 CTGAGGGTCTTTCCTCCAGCTGG - Intergenic
1121251950 14:92506069-92506091 CCCAGGGCCAAGCCTCAAGGTGG - Intergenic
1121951270 14:98172652-98172674 TCCAGGGTCATGCCATCTGCAGG + Intergenic
1122863178 14:104591642-104591664 CCCAGGATGATGCCCCCACCAGG + Intronic
1123043322 14:105499438-105499460 CCCAGGGCCAGGCCCACAGCGGG - Intronic
1123105872 14:105840816-105840838 CCCAGGGCCATGACCCCAGCTGG - Intergenic
1123943319 15:25227066-25227088 CCCCAGCTCATGCATCCAGCAGG - Intergenic
1124169596 15:27360739-27360761 CCCAGGGTCATCTTTGCAGCAGG - Intronic
1124170188 15:27366256-27366278 CCCACGGTCATGCAGCCAGCTGG + Intronic
1126388028 15:48113929-48113951 CCCAAGGTCAAACATCCAGCAGG + Intergenic
1128183849 15:65627440-65627462 CCCAGGGTCATATAGCCAGCAGG + Intronic
1128327908 15:66737146-66737168 CCCGGGTCCCTGCCTCCAGCAGG + Intronic
1128543977 15:68555220-68555242 GGCAGGGCCATGCCTCCATCAGG - Intergenic
1128702073 15:69812285-69812307 CCCAGGGTCATGCAGCTGGCAGG + Intergenic
1129712398 15:77826991-77827013 CTCAGGGTCATGCGTCTGGCTGG + Intergenic
1129787544 15:78319726-78319748 CAGAGGGTAATGCCTCCAGGAGG + Intergenic
1131515901 15:93076466-93076488 CCCAAGGTCTAGCCTGCAGCAGG - Intronic
1132367284 15:101266795-101266817 CAGAGGCTCATGCCTTCAGCTGG + Intergenic
1132809871 16:1792386-1792408 GCCAGGGCCAGGCCTCCTGCGGG + Exonic
1134215533 16:12314126-12314148 CACAGGTGCATGCCACCAGCAGG + Intronic
1134717600 16:16364650-16364672 GCCAGGCACATGCCACCAGCCGG - Intergenic
1134957152 16:18387509-18387531 GCCAGGCACATGCCACCAGCCGG + Intergenic
1136246050 16:28976623-28976645 CCCAGGGTCACACCACCAGTTGG + Intronic
1137671563 16:50282350-50282372 CCCAGCCTCTTGCTTCCAGCAGG + Intronic
1138205555 16:55121826-55121848 CCCAGGGACCTGCCTTGAGCTGG + Intergenic
1138524334 16:57593227-57593249 ACCTGGGTCATGCTGCCAGCAGG + Intergenic
1139203542 16:65003992-65004014 GTCAGGGAAATGCCTCCAGCTGG + Intronic
1141003501 16:80330618-80330640 CCAAGTGCCATGCCTACAGCTGG + Intergenic
1142229132 16:88891446-88891468 CCCAGGGTGCTGGCTCCAGGAGG + Intronic
1142304735 16:89278855-89278877 CCCGAGGTCCTTCCTCCAGCTGG - Intronic
1144385057 17:14741609-14741631 CCCCGTGTCAGGCCTCCAGCAGG + Intergenic
1145946207 17:28776593-28776615 ACCAGGGGCATGCCACCACCTGG + Intronic
1146918043 17:36690667-36690689 CCCCGTGTCATGCCTCAAGGTGG - Intergenic
1149368513 17:55969348-55969370 CCCAGCCTCATGCCCTCAGCAGG - Intergenic
1149666213 17:58366427-58366449 CCTGGGGGCATGCCTCCAGAGGG - Intronic
1149784849 17:59426047-59426069 CCTTGGGTCATGTCTCCAACAGG + Intergenic
1151191189 17:72399361-72399383 CTCAGGGTAGTGACTCCAGCAGG - Intergenic
1151268253 17:72973273-72973295 ACCAGGGTCAGCCATCCAGCGGG + Intronic
1151962875 17:77416487-77416509 GCCAGGGACATGCCGGCAGCAGG + Intronic
1152008818 17:77698201-77698223 CCCAGGGCCAAGCCTCAAGTGGG - Intergenic
1152510466 17:80783602-80783624 GCCAGGCTCATGCATCCAGCAGG + Intronic
1152516554 17:80828240-80828262 CCCAGGAGCATGACTACAGCAGG - Intronic
1152565762 17:81099651-81099673 TGGAGGGTCCTGCCTCCAGCAGG - Intronic
1152797298 17:82314653-82314675 CCCTGGGTCTGGCCTCCACCTGG + Intergenic
1153025552 18:669250-669272 CCCAGGGTCCTGCCTCCCTCAGG - Intronic
1153055017 18:937185-937207 TCCAGGGTCCTTCCTCCAGAGGG - Intergenic
1156457682 18:37303900-37303922 CCCAGGGACTTGTCTCCAGGAGG - Intronic
1160753761 19:747458-747480 CCCGGGGACATGCCCCCACCCGG + Exonic
1160817003 19:1040749-1040771 GCTGGGGTCGTGCCTCCAGCTGG + Intronic
1160901842 19:1432718-1432740 CCCAGGGTCCTGGGGCCAGCGGG - Intronic
1161545485 19:4877954-4877976 CCCCGGGCCAGGCCTCCACCTGG + Intergenic
1161768403 19:6218950-6218972 TCCAGGGTCCTCCCTCCATCAGG + Intronic
1162323694 19:9986032-9986054 CCCAAGGACATGCCCCTAGCAGG - Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1163468988 19:17486160-17486182 CCCAGGGTCCAGCCCCGAGCTGG - Intronic
1163572316 19:18089852-18089874 GCCAGGGTCAGGCGCCCAGCAGG + Intronic
1163795768 19:19337296-19337318 CCCAGGGTCATGGTCCCTGCCGG - Intronic
1164735590 19:30538750-30538772 CCCAGGGTAATGTCTCCATGAGG - Intronic
1165069400 19:33247097-33247119 CCCGGGGTCATCCCTGAAGCAGG + Intergenic
1165330625 19:35139610-35139632 CCCGGGGTCAGGCCGCGAGCGGG + Intronic
1165744756 19:38224149-38224171 CCCCGGGTCCTGCCCCCAGCAGG + Exonic
1166960558 19:46493820-46493842 CCCAGGGGCCTGACTCCGGCCGG - Exonic
1167070871 19:47221436-47221458 CCCAGTGTCACCCCTGCAGCTGG + Exonic
925370610 2:3342567-3342589 CCCAGTCTCCTGCCTCCACCTGG + Intronic
927376194 2:22417442-22417464 CCCAGGGTCCTTCCCCCAACAGG + Intergenic
930204349 2:48573154-48573176 CCCACGGGCATGATTCCAGCAGG + Intronic
930442047 2:51421039-51421061 CACAGGCACATGCCACCAGCAGG - Intergenic
931414324 2:62066526-62066548 CCCAGGTTCATGACTACAGGTGG + Intronic
932377742 2:71252997-71253019 CCCATCGTCATATCTCCAGCTGG - Intergenic
934309325 2:91849398-91849420 CCCAGGATCATGGTGCCAGCAGG - Intergenic
934556491 2:95289518-95289540 CCCAGGGTCCAGGCTCCAGCAGG - Exonic
934897863 2:98134177-98134199 CCCAGGGCCACATCTCCAGCAGG - Intronic
936008891 2:108912190-108912212 CTCAGAGTCAGCCCTCCAGCTGG - Intronic
936061234 2:109297017-109297039 CCCAGGGCCAGGCATACAGCAGG - Intronic
936479378 2:112870889-112870911 CCCAGGGGCCTGCCTCAATCCGG + Intergenic
941868661 2:170360876-170360898 TCCAAGATCAAGCCTCCAGCAGG - Intronic
947224236 2:227824782-227824804 CCAAGTGTCAAGACTCCAGCTGG + Intergenic
948738869 2:240029997-240030019 CCCGGGGCTGTGCCTCCAGCTGG - Exonic
948740943 2:240045640-240045662 CCCGGGGCTGTGCCTCCAGCTGG - Exonic
948831678 2:240601363-240601385 CCCAGGAACATGGTTCCAGCTGG - Intronic
1168918051 20:1507563-1507585 TCCAGGGTCAAGGCACCAGCAGG - Intergenic
1168961751 20:1874822-1874844 CACAGGGTCATGCAGCAAGCTGG - Intergenic
1171186518 20:23127472-23127494 CCCAGGCTCATGGCTCCCACTGG - Intergenic
1172027265 20:31957004-31957026 CCCAAGGTCATGCAGCCAGATGG + Intergenic
1172230127 20:33330811-33330833 CCCATGGTCATGCAGCCAGGAGG - Intergenic
1172980543 20:38938260-38938282 CCCATGCCCCTGCCTCCAGCAGG + Intronic
1173421378 20:42904422-42904444 GCCAAGGTCATGCAACCAGCTGG - Intronic
1173677076 20:44845224-44845246 CCCAGGGTCTGGCATCCAGCAGG + Intergenic
1173736895 20:45368225-45368247 CCCAGAGTCATTCCTCCATTTGG + Exonic
1174068549 20:47883465-47883487 CCCAGTGTCAGGGCTCCAGCCGG - Intergenic
1174076539 20:47941534-47941556 CCCAGGGTCCTGCATAGAGCTGG - Intergenic
1175244917 20:57576283-57576305 CCCAGGGTCTTGCCTCTGGCAGG + Intergenic
1175509674 20:59515413-59515435 CCCAGGGTCCCGGCTCCACCCGG + Intergenic
1175540377 20:59744232-59744254 CCCAGGGTCACACAGCCAGCAGG + Intronic
1175936524 20:62516772-62516794 CCGAGGGCCATGTCTCCAGATGG - Intergenic
1177223681 21:18225989-18226011 TACAGGGTCATTCCTCCAGGAGG - Intronic
1179494705 21:41764255-41764277 CCCTGGGCCAGGCCTTCAGCCGG - Intronic
1179495712 21:41770083-41770105 CCCATGGTCATGCCAGCAGGTGG - Intergenic
1179765846 21:43572407-43572429 CCCAGGGTCCTGTCCACAGCAGG - Intronic
1179920741 21:44505934-44505956 ACCAAGCTCCTGCCTCCAGCAGG - Intronic
1181057232 22:20265949-20265971 CCCAAGGTCACACCGCCAGCAGG + Intronic
1181971943 22:26697462-26697484 CCCAGGGTTCTGCCTGCATCAGG + Intergenic
1182660717 22:31923302-31923324 CCCAAGGTCACGTCTCTAGCCGG - Intergenic
1183959460 22:41402580-41402602 CTCAGTGTGTTGCCTCCAGCTGG + Intergenic
1184715176 22:46277868-46277890 CCCTGGGTCATGCCTCTGGGTGG + Intronic
1184788802 22:46686466-46686488 GCCAAGGTCATGCTCCCAGCCGG + Exonic
1184973280 22:48043093-48043115 GCCAGGGTCCTGCCAGCAGCTGG - Intergenic
1185277794 22:49957207-49957229 CCCACTGTCCTGCCTCCCGCCGG - Intergenic
1185307858 22:50131938-50131960 CCCAAGGTCAAGGCACCAGCAGG + Intronic
949937020 3:9123896-9123918 CCTTGGGTCATCTCTCCAGCTGG - Intronic
950135963 3:10581122-10581144 CCCAAGGTCATGCAACCAGTAGG + Intronic
953637881 3:44677967-44677989 CCCAGGGTGATGCCACCCACAGG + Intergenic
953747043 3:45583138-45583160 GCTAGGCACATGCCTCCAGCTGG + Intronic
953748694 3:45594025-45594047 CCCAGGGGCAGGCCTGCACCCGG - Intronic
954422291 3:50425073-50425095 CCCAGGGCCATGCTTCCACAGGG + Intronic
954687949 3:52380638-52380660 CCCTGGGTCAGGCCTCGTGCAGG + Intronic
957938836 3:86978437-86978459 CTCAGGGGCAAGTCTCCAGCTGG + Intronic
960958360 3:123051098-123051120 CACAGCGTCTTGCCTCCAGCTGG + Intergenic
961574674 3:127824544-127824566 CCCACTGTCTGGCCTCCAGCAGG + Intergenic
961796232 3:129411059-129411081 CCCAGGGTTCTGCAGCCAGCGGG + Intronic
962212620 3:133491644-133491666 ACCAGGGTCTGGCCTGCAGCTGG - Intergenic
962880760 3:139574271-139574293 CCCAGGGTCACACAGCCAGCTGG - Intronic
963644854 3:147901043-147901065 CCATGGGTCATGAGTCCAGCTGG + Intergenic
966199558 3:177347847-177347869 CTCAGGGTCATGCCAGCAGAGGG + Intergenic
968968106 4:3779598-3779620 CCCAAGGCCATGCCTCCTGTGGG + Intergenic
969449455 4:7264776-7264798 CTCAGGGTCTGGCCTGCAGCTGG - Intronic
971757371 4:30721057-30721079 CCCAGAGTCATCCCCTCAGCGGG - Exonic
977667589 4:99658829-99658851 CACAGGGTCATGCCCACTGCTGG + Intergenic
978727267 4:111984127-111984149 CTCAGGTTCATGACTCCAGAGGG + Intergenic
982337965 4:154260817-154260839 CTCAGGGTCTGGCCTCCAGAAGG + Intronic
985577334 5:679424-679446 CCCAGGATCCTGCCCCCAGGCGG - Intronic
985592253 5:771491-771513 CCCAGGATCCTGCCCCCACCAGG - Intergenic
985592267 5:771524-771546 CCCAGGATCCTGCCCCCAGACGG - Intergenic
985635496 5:1033828-1033850 CCCTGTGCCCTGCCTCCAGCGGG - Intronic
985773569 5:1827946-1827968 CGCAGGATCAGGCCTCCGGCAGG - Intergenic
985840128 5:2299841-2299863 CCCAGGGTCAAGCCACCTGCTGG - Intergenic
985851114 5:2389655-2389677 CCCAGGCACATGCCCACAGCAGG + Intergenic
990982163 5:61611768-61611790 CCCAAGGTCATGCAGCTAGCAGG + Intergenic
992795788 5:80254304-80254326 ACCACAGTGATGCCTCCAGCAGG + Intronic
997888294 5:137651282-137651304 CCCAGGCTGATGCCTCAGGCAGG - Intronic
1001210762 5:169808224-169808246 CCCTGGGCAATGCCTCCAGTAGG - Intronic
1002319174 5:178364880-178364902 CCCAGGCCCCAGCCTCCAGCAGG + Intronic
1002692270 5:181058886-181058908 CGCAGGGTGGTGCCACCAGCAGG + Intronic
1002699094 5:181109914-181109936 CCCAGGGCAATGCCTACAGAGGG + Intergenic
1002952014 6:1823481-1823503 CCCAGGGTCTTTCCACCAGAAGG - Intronic
1003020134 6:2502582-2502604 ACCAGGGCCAGGCCTGCAGCAGG - Intergenic
1005812689 6:29529216-29529238 TCCAGGGCCATGGCTCCAGAAGG - Intergenic
1005835885 6:29709347-29709369 CTCAGGGGCATGCTGCCAGCAGG - Intergenic
1006519869 6:34564964-34564986 CCCAGGGGCCTGGCTCCTGCTGG + Intergenic
1006803010 6:36771350-36771372 CCCAGTGTCTTGCTGCCAGCCGG - Intronic
1006908829 6:37550735-37550757 CCCAAGGTCATGCATCGTGCAGG - Intergenic
1006934568 6:37708353-37708375 CCCTGGGTCAGGCCTCAGGCAGG - Intergenic
1007107583 6:39294378-39294400 CCCAGGGTCGTGGCATCAGCTGG - Intergenic
1007701420 6:43768628-43768650 GCCAGGGTCTGGCCTACAGCTGG - Intergenic
1010951343 6:82040582-82040604 CCAAGGGCTATGCTTCCAGCAGG - Intergenic
1011725280 6:90204781-90204803 CCCAGGGTCATGACTGGAGGTGG - Intronic
1012229822 6:96747690-96747712 CCCAGGGACAAGCAGCCAGCAGG + Intergenic
1017186326 6:151604374-151604396 CCCAGGAGCATGCCTCTTGCTGG - Intronic
1017742344 6:157417981-157418003 CCCAGGGTCAGGCCGACTGCAGG + Intronic
1017815959 6:158016910-158016932 CCCAGGTGCCTGCCCCCAGCTGG + Intronic
1019014751 6:168871798-168871820 CCCACGGCCATGCAGCCAGCCGG + Intergenic
1019621330 7:1993871-1993893 CCCAGGGCCAGGCATTCAGCTGG - Intronic
1019685909 7:2382084-2382106 ACCAAGGCCATGCCTGCAGCAGG - Intergenic
1019884120 7:3889334-3889356 CCCAGAGTCAGGCCTACAGTTGG + Intronic
1021810225 7:24395762-24395784 CCCAGGGCCACCCCTGCAGCTGG + Intergenic
1023865334 7:44235685-44235707 GCCAGGGCCATGCGGCCAGCCGG + Intronic
1025758808 7:64371184-64371206 GCCAGGGCCATGCCTCAAGGAGG + Intergenic
1026026517 7:66749043-66749065 CACTGGGTCATGCCACCACCAGG - Intronic
1026806700 7:73433696-73433718 CCCAGGGACACGCCTCCCACTGG - Intergenic
1026896470 7:74012815-74012837 CCCAGGTTCAGGCCCTCAGCTGG + Intergenic
1031890245 7:127286101-127286123 CCCAGGGTCATACGGCCAGCGGG - Intergenic
1034448500 7:151125492-151125514 CCCAGAGTGGTGCCGCCAGCTGG + Intronic
1036381280 8:8237905-8237927 CCCAGGCCCAGGCCTCCTGCAGG + Intergenic
1036643315 8:10597461-10597483 CCCAGGGACAGGCCTTGAGCTGG + Intergenic
1037767302 8:21780181-21780203 GCCAGGCTCCTCCCTCCAGCAGG + Intronic
1037934239 8:22903911-22903933 CCAATGGTCAAGGCTCCAGCTGG + Intronic
1041282928 8:56229717-56229739 CTCAGGGTCAAGCCTGGAGCTGG + Intergenic
1042869353 8:73383368-73383390 CTCTGGGTCTTGGCTCCAGCTGG + Intergenic
1045345165 8:101287546-101287568 CCCAAGGTCAGGCCTCCTGCAGG - Intergenic
1045883584 8:107069543-107069565 CCCAAGGTCATGCCTTCCTCGGG - Intergenic
1046412106 8:113859197-113859219 CCCAGGGTCTTGCCTGCACATGG + Intergenic
1046642908 8:116752547-116752569 CCCAAGGTCATGCTTACTGCTGG + Intronic
1049267969 8:141679552-141679574 CCCAGGGTCAGACCTCCCACAGG - Intergenic
1049420075 8:142512545-142512567 CCCGGTGTCAGGCCTGCAGCAGG + Intronic
1049443680 8:142620395-142620417 CCCAGGGTCATGCCTCCATCTGG - Intergenic
1052300479 9:26947392-26947414 CCCAGGGTCAGGCGTCCTGGTGG - Exonic
1052419407 9:28223236-28223258 TCCAAGATCAAGCCTCCAGCAGG + Intronic
1053148615 9:35728785-35728807 CCCAGGGTCTTCCCCACAGCTGG - Intronic
1053443691 9:38135864-38135886 CCCAGGGTAAAGGCTCCAGAAGG + Intergenic
1057303815 9:93901301-93901323 CCCAGGGCCATGCCCTCTGCTGG - Intergenic
1060521600 9:124297178-124297200 CCCAGGGTCATCCCTGCCCCAGG - Intronic
1060590702 9:124814539-124814561 CTCAGGGTCACGTCTCCAACAGG + Exonic
1060810714 9:126610316-126610338 CCCAGATCCGTGCCTCCAGCTGG + Intergenic
1060855254 9:126909889-126909911 CCAAGGGTCAAGCCTCAACCCGG - Intergenic
1061683879 9:132259202-132259224 CCCAGGGTCACCCCCCCACCAGG - Intergenic
1061884065 9:133582789-133582811 CCCAAGGTCAAGCGACCAGCAGG - Intronic
1062186772 9:135222423-135222445 CACAGGGCCAGGCCTCCTGCAGG + Intergenic
1062254923 9:135616374-135616396 ACCAGGGTCATGCAGCCAGGAGG - Intergenic
1062641435 9:137520738-137520760 CCCAGGGTCACACCGCCAGGAGG + Intronic
1186205015 X:7191741-7191763 CCCAGGTTCATCCCTGCAGGAGG + Intergenic
1189030200 X:37442108-37442130 CCCTGGGTCAGGCCACCAGGCGG + Intronic
1190123917 X:47686742-47686764 CCCAATGCCATGCCCCCAGCAGG - Intergenic
1192177361 X:68894418-68894440 CCCAGCAGCAAGCCTCCAGCTGG - Intergenic
1192619410 X:72662469-72662491 CCCAGGGACATGGGTCCATCAGG - Intronic
1192964834 X:76166342-76166364 TCCAGGATCATGGCACCAGCTGG + Intergenic
1200891831 Y:8332236-8332258 CACAGGGCCATGCCTCAAGGAGG + Intergenic
1200904258 Y:8465210-8465232 CCTTGTGTCATGCCCCCAGCAGG + Intergenic