ID: 1077231107

View in Genome Browser
Species Human (GRCh38)
Location 11:1458559-1458581
Sequence CCCCCAGAGACTGCGGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077231098_1077231107 -2 Left 1077231098 11:1458538-1458560 CCTCCTCAGACACTGCCCACCCC 0: 1
1: 1
2: 4
3: 49
4: 570
Right 1077231107 11:1458559-1458581 CCCCCAGAGACTGCGGCCGAGGG 0: 1
1: 0
2: 1
3: 5
4: 125
1077231099_1077231107 -5 Left 1077231099 11:1458541-1458563 CCTCAGACACTGCCCACCCCCCC 0: 1
1: 0
2: 35
3: 114
4: 787
Right 1077231107 11:1458559-1458581 CCCCCAGAGACTGCGGCCGAGGG 0: 1
1: 0
2: 1
3: 5
4: 125
1077231097_1077231107 9 Left 1077231097 11:1458527-1458549 CCAGCAGGGGGCCTCCTCAGACA 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1077231107 11:1458559-1458581 CCCCCAGAGACTGCGGCCGAGGG 0: 1
1: 0
2: 1
3: 5
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077231107 Original CRISPR CCCCCAGAGACTGCGGCCGA GGG Intronic
900537200 1:3184742-3184764 CCCCCAGAGACAGAAGCAGATGG - Intronic
900568385 1:3346559-3346581 CCCCCAAAGACTGGGGACGGTGG - Intronic
900923288 1:5687448-5687470 CCCCCAGAGAATGGAGCCAAGGG + Intergenic
903203837 1:21765506-21765528 ACTCCAGAGACTGAGGCAGAAGG + Intronic
904257138 1:29260920-29260942 CCACCAGAGACTGAGGCCAGGGG - Intronic
904374009 1:30068482-30068504 CCCCCAGAGAGGGCAGGCGATGG + Intergenic
904494202 1:30877601-30877623 CCCCCAGAGGCAGAGGCGGAGGG + Intronic
907485655 1:54776293-54776315 CCACCAGAGACTCCGGCCCCAGG + Intergenic
915524594 1:156468027-156468049 GCCCCAGAGCCTGAGGCTGAGGG - Exonic
915657725 1:157375522-157375544 ACCCCAGAGACTGCGACCCTAGG + Intergenic
916497159 1:165356437-165356459 GCCCCCGAGACTGCAGCCGGAGG + Exonic
918601955 1:186375045-186375067 ACCCCAGTGGCAGCGGCCGACGG + Exonic
920180718 1:204130294-204130316 CCCCCCGAGGCTGCTGCCCATGG + Intergenic
920839170 1:209539451-209539473 CCCCCAGAGACTGGGGACATAGG - Intergenic
922925477 1:229343327-229343349 CCCCCCCAGGCTGCGGCCGGGGG + Intergenic
924709000 1:246519054-246519076 CTCCCAGACACTGCAGCAGATGG + Intergenic
1067539958 10:47144047-47144069 CCTCCAGAGCCTGAGGCCAATGG - Intergenic
1069832459 10:71289627-71289649 CCCCCAGTGAGCTCGGCCGAGGG - Intronic
1072224593 10:93356738-93356760 CCTCCAGCGTCTGCGGCGGAAGG + Exonic
1076185153 10:128440864-128440886 CCCCTAGAGGCTGAGGCCCAGGG - Intergenic
1076496193 10:130899261-130899283 CCCCCAGAGACTGCTGTAGTGGG - Intergenic
1077124134 11:925082-925104 ACCCCAGTGACAGCGGCCGGGGG - Intronic
1077231107 11:1458559-1458581 CCCCCAGAGACTGCGGCCGAGGG + Intronic
1078057776 11:8021129-8021151 CCCCAAGAAACTGTGGCCCAGGG - Intronic
1078363835 11:10691025-10691047 GCCCCAGAGAGAGCGGCTGAGGG + Intronic
1080521642 11:33072527-33072549 CCCCCAGGGACTGTGGGCAATGG - Exonic
1081393155 11:42553685-42553707 CCTCCAGAGGCTGAGGCTGAAGG - Intergenic
1083329795 11:61892027-61892049 CCCGCAGAGATTGGGGCCCATGG - Intronic
1083663882 11:64264479-64264501 CCCCCAGGGCCTGCGGCAGGCGG + Intronic
1087814115 11:102639430-102639452 CTCACAGAAACTGCGGCTGATGG - Intergenic
1097178637 12:57158326-57158348 CACCCAGGGGCTGCGGCCAAGGG - Intronic
1099574270 12:84361666-84361688 CCCCCACAGCCTGCTGCCCAGGG + Intergenic
1104289752 12:127456222-127456244 CCCCCAGAGACCGCGGTGGGGGG - Intergenic
1112021475 13:95374870-95374892 CCCCAAGTGACTGAGGCCAATGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118327780 14:64793181-64793203 CCCGCAGGGCCTGCAGCCGATGG + Exonic
1118992501 14:70809266-70809288 CCCCCAACGACGGCGGCCGCAGG + Exonic
1122152211 14:99731350-99731372 CCCCCAGTGACTGCCGGGGAGGG - Intergenic
1123506302 15:20943030-20943052 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1123563528 15:21516734-21516756 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1123599780 15:21954021-21954043 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1125748846 15:42015096-42015118 GCCCCAGACACTGCAGCCCAGGG - Intronic
1128336243 15:66787404-66787426 CCCCCAGAGCCTGGGCCTGAAGG - Intergenic
1131827187 15:96331219-96331241 CACCCAGCGACTGCGGGCGGCGG + Exonic
1202971886 15_KI270727v1_random:243871-243893 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1133220975 16:4319036-4319058 GCCCCAGAGGCTGCCTCCGAAGG + Intronic
1138208796 16:55145686-55145708 CCCCCATAGACTGTGGCAGCTGG + Intergenic
1141212496 16:81994438-81994460 GGCCCAATGACTGCGGCCGAAGG + Exonic
1141427357 16:83952970-83952992 CCTCCAGAGACTGAGCCCCAGGG + Intronic
1143562302 17:7703301-7703323 CCCACAGAGAGTGGGGACGAAGG + Exonic
1144106670 17:11992442-11992464 CCCCCAGAGACTGTGGCAATGGG - Exonic
1144676824 17:17167363-17167385 CCTCCAGACACTGCTGCTGATGG - Intronic
1144785247 17:17827776-17827798 CCCCCACAGGCTGGGGCTGAAGG - Intronic
1144948163 17:18980381-18980403 CCCTCAGAGACTGTGGCCAAGGG + Intronic
1145403625 17:22568314-22568336 CCTCCAGAGACTGCAGGAGAAGG + Intergenic
1148049241 17:44761007-44761029 CCCCCAGTGACTGCGGGCCTTGG - Intronic
1148562334 17:48613230-48613252 GCCCCAGAGGCGGCGGACGAGGG - Exonic
1153045562 18:852754-852776 TCCCCTGAGACTGCGACAGAGGG + Intergenic
1154172620 18:12062169-12062191 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1154485453 18:14868317-14868339 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1161175962 19:2842100-2842122 CCCCCAGAGACCGCGGCCGGAGG - Intronic
1161304061 19:3557343-3557365 CCACCAGGGACAGCGGCCGCGGG + Exonic
1161613653 19:5257761-5257783 TCCCCAGAGCCTGCTGCCCACGG + Intronic
1166297547 19:41896445-41896467 CCCCCAGAGAGTACCGACGAGGG + Exonic
1168445203 19:56405656-56405678 CCCCCAGAGACTGAGAGGGATGG - Intronic
925193230 2:1902412-1902434 CCCCCTGTGACTGGGGACGATGG - Intronic
925640957 2:5985508-5985530 CCCCCAGAGACTTCGCACAACGG + Intergenic
926077112 2:9950980-9951002 GCCCCAGGGACTGCCGCCGAGGG + Intergenic
928860860 2:35855698-35855720 CAACCAGAGACTGAGGCAGATGG - Intergenic
929575514 2:43049528-43049550 CGCCCAGGGACTGGGGCCCACGG - Intergenic
930013674 2:46956509-46956531 CCCCCAAAGACTGCAGCCCCAGG - Intronic
931763783 2:65437117-65437139 TCCACAGAGACAGCGGCCTAGGG - Intergenic
937954378 2:127412455-127412477 ACCCCAGAAACAGAGGCCGAAGG - Intergenic
938196680 2:129334779-129334801 CCTGCAGAGACGGCAGCCGAGGG + Intergenic
948347952 2:237314933-237314955 CCCCAAGGGACTGAGGCTGAGGG + Intergenic
948835225 2:240623117-240623139 CCCACAGCGACTCCGGCCGCGGG - Intronic
1176247307 20:64103523-64103545 CCCCCAGAGCCAGCGACCCAGGG - Intergenic
1176795883 21:13371160-13371182 CCTCCAGAGACTGCAGGAGAAGG + Intergenic
1178953781 21:37006255-37006277 CCCCGAGGGAGTGCGCCCGACGG + Intronic
1181005179 22:20010031-20010053 CCCCCAGAGACTGGAGCCACAGG - Intronic
1181469893 22:23131824-23131846 CCCCCAGAGACTGCTCCTGGTGG + Intronic
949534484 3:4985489-4985511 TCCCCAGACACTGCTGCCCACGG - Intergenic
953561615 3:43997074-43997096 GCCCCAGAGACCGAGGCAGACGG - Intergenic
953905767 3:46867618-46867640 CCTGCGGAGACTGCGGCCCAGGG - Intronic
954085477 3:48240923-48240945 ACCCCAAATATTGCGGCCGAGGG + Intergenic
954615447 3:51966938-51966960 CCCCCAACGACTGCGGAGGATGG + Intronic
954628326 3:52034957-52034979 TCCCCAGAGAATGTGGCCCATGG - Intergenic
956050464 3:65242673-65242695 CTCTCAGAGACTGCGGTTGAGGG - Intergenic
968284346 3:197499292-197499314 CCCCCAGGGCCTGGGGCCGCTGG - Intergenic
968975814 4:3821574-3821596 CCCTCAGAGGCTGCGGACGGTGG + Intergenic
970909286 4:21255532-21255554 CACCCAGAGGCTGAGGCTGAGGG - Intronic
975526200 4:75353078-75353100 CCCAGAGAGACTGCTGCTGAGGG + Intergenic
981102363 4:140843230-140843252 CACCCAGAGACTCCTGCTGATGG - Intergenic
984057688 4:174949505-174949527 CCCCCAGTGACTCCTGGCGAAGG - Intronic
985638750 5:1053219-1053241 CTCCCAGAGCCTGGGGCTGAAGG + Intronic
986051756 5:4096788-4096810 CCCCAAGAGCCTGTGGCCGCAGG + Intergenic
992812151 5:80399472-80399494 CCCACAGAGACTCAGGCTGATGG + Intergenic
993397509 5:87408608-87408630 CCCTTAGAGACTTCTGCCGATGG - Intronic
996605012 5:125311645-125311667 CCCCCAGTGACTGCAGCCCCAGG + Intergenic
998511529 5:142718308-142718330 CCCTCAGAGCCTTCGGCCCAGGG - Intergenic
1002706117 5:181161622-181161644 CCTCCAGAGACTACAGCAGAGGG + Intergenic
1003631842 6:7794489-7794511 CCTCCAGAGGCTGAGGCAGAAGG + Intronic
1007128543 6:39448094-39448116 TCCCCAGAGACCGAGGCTGATGG - Intronic
1018903262 6:168061657-168061679 CCCCCAGATGCTGAGGTCGAAGG - Intronic
1019475532 7:1242402-1242424 CCCCCACAGGCTGCGCCTGACGG + Intergenic
1019706113 7:2498035-2498057 CCCCGAGAGACAGAGGCAGATGG + Intergenic
1021227957 7:18050789-18050811 GCCCCAGAGACAGTGGCTGAAGG + Intergenic
1022467337 7:30660696-30660718 CCCCCACAGACTTGGGCCCAGGG + Intronic
1025980378 7:66400336-66400358 ACCCCAGAGTCTGAGGCAGAAGG + Intronic
1026471376 7:70695587-70695609 CCCCCGGGGTCTGCGTCCGAAGG + Intronic
1026594597 7:71723858-71723880 CCTCCAGAGACTGAGGCAGGAGG + Intergenic
1026661059 7:72302962-72302984 ACCACAGAGACTGAGGCAGAAGG + Intronic
1027151973 7:75739328-75739350 CGCGCGGGGACTGCGGCCGAGGG - Intergenic
1027205265 7:76092721-76092743 ACCCCAGAGGCTGAGGCGGAAGG + Intergenic
1027385294 7:77653846-77653868 CCCCAAGAGACTGAAGCAGAAGG - Intergenic
1029713757 7:102314529-102314551 CCCCCAGAGACGACAGCCGTGGG + Exonic
1033595470 7:142855359-142855381 CCTGCAGAGACTGCGGCCAACGG + Exonic
1034964719 7:155384032-155384054 CCCCCAGAGAAGGCGGGCGTGGG - Intronic
1035749382 8:1985148-1985170 CCCCCAAAGAGGGTGGCCGATGG + Intronic
1043296213 8:78666291-78666313 CCTCCGGAGGCTGGGGCCGAAGG + Intronic
1049391327 8:142373112-142373134 CACCCAGAGACAGAGGCTGAGGG - Intronic
1050815069 9:9800224-9800246 ACTCCAGAGACTGAGGCGGAAGG + Intronic
1052860418 9:33434793-33434815 CACCCTGAGACTGCGGCCCACGG + Intergenic
1057126519 9:92620030-92620052 CCACCAGAGACAACGGCAGACGG + Exonic
1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG + Intergenic
1057763111 9:97892106-97892128 CCCCCAGATCCTGCTGCTGACGG - Intergenic
1059561336 9:115337823-115337845 ACTCCAGAGACTGAGGCAGAAGG - Intronic
1061850115 9:133409948-133409970 CCCTCAGAGACTGCTGCCGTGGG - Intronic
1062003890 9:134229864-134229886 CCCCCAGGGGCTGCCCCCGACGG + Intergenic
1062139349 9:134947365-134947387 CTCCCAGAGCCGGCGGCCCACGG + Intergenic
1190096164 X:47482829-47482851 CTCCTAGAGGCTGCGGCGGAGGG - Exonic
1200085794 X:153604173-153604195 CCCCCAGAGCCTGCAGAGGAGGG - Intergenic