ID: 1077231430

View in Genome Browser
Species Human (GRCh38)
Location 11:1459672-1459694
Sequence GGGCCTCCATCGACACACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077231416_1077231430 27 Left 1077231416 11:1459622-1459644 CCCACAGCTCAGGGCTCAGGTGG 0: 1
1: 1
2: 1
3: 33
4: 317
Right 1077231430 11:1459672-1459694 GGGCCTCCATCGACACACCTGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1077231418_1077231430 26 Left 1077231418 11:1459623-1459645 CCACAGCTCAGGGCTCAGGTGGG 0: 1
1: 0
2: 4
3: 41
4: 399
Right 1077231430 11:1459672-1459694 GGGCCTCCATCGACACACCTGGG 0: 1
1: 0
2: 0
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077231430 Original CRISPR GGGCCTCCATCGACACACCT GGG Intronic
901724331 1:11228835-11228857 GGGCCACCATGGACACAGCTGGG + Exonic
902844501 1:19099297-19099319 GAGCCTCCTTCGACACCCCCTGG + Intronic
902850672 1:19153668-19153690 GGGCCTCCATTGAAAGAGCTGGG + Intronic
903535599 1:24064294-24064316 GGGCCTCCATTTACTCATCTGGG + Intronic
904563311 1:31413093-31413115 GGGCCTCCCCAGACTCACCTGGG - Intronic
905448184 1:38040983-38041005 GGGCCTCCAATGACACATCCAGG - Intergenic
906393219 1:45437026-45437048 TGGCCTCAATCCACCCACCTTGG + Intronic
915325950 1:155081147-155081169 CGGCCTCCTTTGACAGACCTGGG + Intronic
920032325 1:203044826-203044848 GGGCCTCCAACCTCCCACCTTGG - Intronic
922767516 1:228163577-228163599 GGGCCTCCATGGCCACATCCAGG + Intergenic
924385171 1:243493110-243493132 GGGCCTCCAGACACACACCCTGG + Intronic
1071787843 10:88922397-88922419 GGGCTTTCATCCACACACCAAGG + Exonic
1075923882 10:126235302-126235324 GAGCCTCCTCCGACACACCCAGG - Intronic
1077231430 11:1459672-1459694 GGGCCTCCATCGACACACCTGGG + Intronic
1077322403 11:1948152-1948174 GGGCCTCCAAAGCCACACCCTGG - Intronic
1081659637 11:44880098-44880120 GGGCCTCCATTACCACATCTTGG + Intronic
1084331451 11:68432898-68432920 TGGCCTCCATGGTCACACGTAGG + Intronic
1084467597 11:69335291-69335313 GAGCCTCGGTGGACACACCTGGG + Intronic
1085303687 11:75473351-75473373 GGGCCTCCATCCACCCACGCTGG + Intronic
1085399684 11:76228369-76228391 GTGCCTCCATCGACAAGCCTGGG + Intergenic
1087386416 11:97474656-97474678 TGTCCTCCATGGGCACACCTAGG + Intergenic
1089023439 11:115242207-115242229 GGGCCTGCATTCTCACACCTGGG - Intronic
1202805421 11_KI270721v1_random:3465-3487 GGGCCTCCAAAGCCACACCCTGG - Intergenic
1097190270 12:57216419-57216441 GCGCCTGCCCCGACACACCTTGG + Intergenic
1104037166 12:125105474-125105496 TGGCCTCCATCCATACACCTGGG - Intronic
1104776267 12:131391894-131391916 GAGCCTCCCTCTGCACACCTGGG - Intergenic
1107302602 13:38981272-38981294 GTGCCTCCACCGATAAACCTTGG - Intronic
1113836207 13:113330172-113330194 GGGTTTCCATCCACGCACCTGGG - Intronic
1113836216 13:113330212-113330234 GGGTTTCCATCCACGCACCTGGG - Intronic
1113836226 13:113330252-113330274 GGGCTCCCATGCACACACCTGGG - Intronic
1113836237 13:113330311-113330333 GGGTTTCCATCCACGCACCTGGG - Intronic
1113836242 13:113330331-113330353 GGGCTCCCATGCACACACCTGGG - Intronic
1113836247 13:113330351-113330373 GGGTTTCCTTCCACACACCTGGG - Intronic
1113836251 13:113330371-113330393 GGGCTTCCATGCACACACCTGGG - Intronic
1113836255 13:113330391-113330413 GGGTTTCCATGCACACACCTGGG - Intronic
1113836276 13:113330471-113330493 GGGCTCCCATGCACACACCTGGG - Intronic
1113836281 13:113330491-113330513 GGGCTCCCATGCACACACCTGGG - Intronic
1113836285 13:113330511-113330533 GGGTTTCCATGCACACACCTGGG - Intronic
1113836290 13:113330531-113330553 GGGCTCCCATGCACACACCTGGG - Intronic
1113836295 13:113330551-113330573 GGGCTCCCATGCACACACCTGGG - Intronic
1113836299 13:113330571-113330593 GGGTTTCCATGCACACACCTGGG - Intronic
1113836304 13:113330591-113330613 GGGCTCCCATGCACACACCTGGG - Intronic
1113836309 13:113330611-113330633 GGGCTCCCATGCACACACCTGGG - Intronic
1113836314 13:113330631-113330653 GGGCTCCCATGCACACACCTGGG - Intronic
1113836318 13:113330651-113330673 GGGTTTCCATGCACACACCTGGG - Intronic
1113836323 13:113330671-113330693 GGGCTCCCATGCACACACCTGGG - Intronic
1113836327 13:113330691-113330713 GGGTTTCCATGCACACACCTGGG - Intronic
1113836337 13:113330731-113330753 GGGCTCCCATGCACACACCTGGG - Intronic
1113836348 13:113330790-113330812 GGGTTTCCATCCACGCACCTGGG - Intronic
1113836353 13:113330810-113330832 GGGCTCCCATGCACACACCTGGG - Intronic
1113836358 13:113330830-113330852 GGGTTTCCTTCCACACACCTGGG - Intronic
1113836362 13:113330850-113330872 GGGCTTCCATGCACACACCTGGG - Intronic
1113836366 13:113330870-113330892 GGGTTTCCATGCACACACCTGGG - Intronic
1113836405 13:113331049-113331071 GGGTTTCCATCCACGCACCTGGG - Intronic
1113836415 13:113331089-113331111 GGGCTCCCATGCACACACCTGGG - Intronic
1122344774 14:101051631-101051653 GGGACTCCTCTGACACACCTGGG + Intergenic
1122931589 14:104935336-104935358 AGGCCTCTTTCCACACACCTGGG + Exonic
1122998869 14:105281166-105281188 CGGCCTCCACCTGCACACCTGGG - Intronic
1122999405 14:105284398-105284420 TGGCCAGCACCGACACACCTAGG - Intronic
1123123076 14:105927039-105927061 GAGCCTCCAGAGACAGACCTGGG - Intronic
1123405714 15:20018457-20018479 GAGCCTCCAGAGACAGACCTGGG - Intergenic
1123406249 15:20020894-20020916 GAGCCTCCAGAGACAGACCTGGG - Intergenic
1123515044 15:21025105-21025127 GAGCCTCCAGAGACAGACCTGGG - Intergenic
1123515579 15:21027542-21027564 GAGCCTCCAGAGACAGACCTGGG - Intergenic
1127959531 15:63880398-63880420 GGGCCCCCAACAGCACACCTGGG + Intergenic
1132739559 16:1404747-1404769 GGGCTTCCATCCACACAACATGG + Intronic
1137407302 16:48199771-48199793 GGGGCTCCATCCTCCCACCTTGG + Intronic
1138594493 16:58022597-58022619 GGGCCTCCATCAACAAGCCCAGG + Intergenic
1138923052 16:61556144-61556166 GGGACTCCAGCGACCCACCCCGG + Intergenic
1140299167 16:73739546-73739568 GGAGCTCCATGGGCACACCTTGG + Intergenic
1148479868 17:47953095-47953117 GGGCCTCCAGCGTCAGGCCTCGG + Exonic
1150122026 17:62612006-62612028 GGTCCTCCATCTACAAACCATGG - Intronic
1151933282 17:77246847-77246869 CGGCCGCCACCGGCACACCTGGG - Intergenic
1151944498 17:77312115-77312137 GGGCCTCCATCATCCCTCCTTGG + Intronic
1153109003 18:1561219-1561241 GGGTCACCATGTACACACCTGGG + Intergenic
1155026223 18:21943254-21943276 TGGCCTCAATCCACCCACCTCGG - Intergenic
1156460212 18:37317485-37317507 GGGCCTCCATCTCCTTACCTGGG - Intronic
1159094728 18:63889929-63889951 GGGCTTCCTTAGACAGACCTGGG + Exonic
1162719813 19:12655760-12655782 GGGCTTCCAGCGAGGCACCTGGG + Exonic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1167433180 19:49464758-49464780 TGGCCCCCAACGACTCACCTGGG - Exonic
925931288 2:8710009-8710031 AGGCCTTCATCCAAACACCTTGG - Intergenic
928385199 2:30861468-30861490 GGGCCTCCCTTTACTCACCTGGG + Intergenic
929576240 2:43054655-43054677 GGGCTTGCATTGACACTCCTGGG - Intergenic
933698289 2:85236496-85236518 GGGGCTCCAGGGACACACCAGGG - Intronic
937158011 2:119734977-119734999 GGTCCTCCTGAGACACACCTAGG - Intergenic
941022695 2:160425767-160425789 TGGTCTCCATAGACCCACCTAGG + Intronic
947328565 2:229004188-229004210 GGGTCTACATCGAAACCCCTAGG - Intronic
1169200567 20:3707195-3707217 GGGCCTCCAGGGACACCTCTGGG + Intergenic
1170886018 20:20340441-20340463 GGCCCTCCATCTAAACACCCAGG - Intronic
1171449638 20:25226527-25226549 GGGCCACCATCCGCCCACCTCGG + Exonic
1172711017 20:36923669-36923691 AGGCCTGCACCGTCACACCTGGG - Intronic
1176367216 21:6040379-6040401 GGGCCTTCATCCACCCAGCTGGG - Intergenic
1179756303 21:43498167-43498189 GGGCCTTCATCCACCCAGCTGGG + Intergenic
1180950823 22:19719746-19719768 GGGGCTCCAACGACAGAGCTTGG - Intronic
1181681618 22:24499502-24499524 GGGCTTCCATCTGAACACCTGGG + Intronic
1182336044 22:29584145-29584167 GTGCTTCCATCAACCCACCTGGG - Intergenic
949754379 3:7392382-7392404 GGGCCTCCATAGCCAAAACTGGG - Intronic
953908052 3:46878210-46878232 GAGCCTCCAGCGACTCAGCTGGG + Intronic
954318416 3:49813778-49813800 GGGCATCCATCCTCAAACCTGGG + Exonic
954611992 3:51949409-51949431 GGGCCTCCAGCCACACTCCAGGG + Intergenic
954699263 3:52442963-52442985 GGGCCTCCACCTCCACTCCTTGG - Intronic
958547046 3:95567342-95567364 GGGCCTCCATGGCCAGAACTGGG + Intergenic
964255768 3:154772772-154772794 GGGCCTCCAGCCACACTCATTGG - Intergenic
968334381 3:197900816-197900838 TGGCCTTCCTAGACACACCTTGG + Intronic
968560396 4:1277877-1277899 GGGTCTCCATCTGCCCACCTGGG - Intergenic
969619943 4:8273847-8273869 GGGCCCCCATCCACACAGCTGGG - Intronic
975823834 4:78299254-78299276 TGGCCTCAATCGACAGACTTAGG - Intronic
980337093 4:131489887-131489909 TGGCCTCCACTGATACACCTTGG + Intergenic
982722030 4:158869199-158869221 GGGCCCCGCTGGACACACCTGGG - Exonic
1003113698 6:3269282-3269304 AGGCCTCCCTCCACCCACCTCGG + Intronic
1021009347 7:15442685-15442707 GGGCCTCTACCCACAGACCTAGG + Intronic
1023867456 7:44244977-44244999 GGGCCTCCACCCACTCACGTTGG - Intronic
1024231898 7:47369123-47369145 GGGCCTCAGTCGGCCCACCTGGG - Exonic
1037781199 8:21870291-21870313 AGGCCTGCATCACCACACCTGGG - Intergenic
1048200906 8:132373162-132373184 GGGCCTCCAGCGTCAGACATGGG + Intronic
1048974180 8:139661986-139662008 GAGCCCCTCTCGACACACCTTGG - Intronic
1049245717 8:141561264-141561286 GGGCCTCCATGGGCACAGCCAGG - Intergenic
1049604340 8:143522022-143522044 GGGACCCCAGAGACACACCTGGG - Intronic
1061928828 9:133821814-133821836 GGGCCTCCACGGCCAGACCTGGG + Intronic
1062657905 9:137613669-137613691 GGGCCGCCATCCACACGCCACGG + Exonic
1189723035 X:43940099-43940121 GGGACTCCAACGAAACACCGGGG - Intergenic
1190663146 X:52673545-52673567 GGGCCTCCAAGGAAACCCCTGGG - Intronic
1190676277 X:52784937-52784959 GGGCCTCCAAGGAAACCCCTGGG + Intronic
1194459022 X:94142893-94142915 GGGCCCCCACAGACAGACCTTGG + Intergenic