ID: 1077231853

View in Genome Browser
Species Human (GRCh38)
Location 11:1461293-1461315
Sequence CACCGCCTCCACGCCGCACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077231845_1077231853 14 Left 1077231845 11:1461256-1461278 CCTGGTGGGCAACGTAGCCACAG 0: 1
1: 0
2: 2
3: 14
4: 93
Right 1077231853 11:1461293-1461315 CACCGCCTCCACGCCGCACCTGG 0: 1
1: 0
2: 0
3: 17
4: 167
1077231843_1077231853 16 Left 1077231843 11:1461254-1461276 CCCCTGGTGGGCAACGTAGCCAC 0: 1
1: 0
2: 1
3: 7
4: 67
Right 1077231853 11:1461293-1461315 CACCGCCTCCACGCCGCACCTGG 0: 1
1: 0
2: 0
3: 17
4: 167
1077231848_1077231853 -3 Left 1077231848 11:1461273-1461295 CCACAGGAACAGGCCCCGTCCAC 0: 1
1: 0
2: 2
3: 11
4: 220
Right 1077231853 11:1461293-1461315 CACCGCCTCCACGCCGCACCTGG 0: 1
1: 0
2: 0
3: 17
4: 167
1077231844_1077231853 15 Left 1077231844 11:1461255-1461277 CCCTGGTGGGCAACGTAGCCACA 0: 1
1: 0
2: 1
3: 8
4: 162
Right 1077231853 11:1461293-1461315 CACCGCCTCCACGCCGCACCTGG 0: 1
1: 0
2: 0
3: 17
4: 167
1077231842_1077231853 22 Left 1077231842 11:1461248-1461270 CCAGGACCCCTGGTGGGCAACGT 0: 1
1: 0
2: 2
3: 5
4: 124
Right 1077231853 11:1461293-1461315 CACCGCCTCCACGCCGCACCTGG 0: 1
1: 0
2: 0
3: 17
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077231853 Original CRISPR CACCGCCTCCACGCCGCACC TGG Exonic
900109319 1:998884-998906 CCCCGCAGCCACGCCGCGCCGGG - Intergenic
900109346 1:999069-999091 CACGGCCTCCAGGGCCCACCCGG + Exonic
900172113 1:1274175-1274197 CTCCGCTCCCACGCCCCACCCGG + Intergenic
900228291 1:1543123-1543145 CAGCACCTCCACGCCGCAGCAGG + Intronic
900737888 1:4310549-4310571 CACAGCCCCCGCGCAGCACCAGG - Intergenic
901323943 1:8356063-8356085 CACGGCCTCCCCGCCCCTCCTGG + Intronic
901790339 1:11650539-11650561 CTCCTCCTCCACGCCGCCCTCGG + Exonic
902888730 1:19426056-19426078 CACCTCCTCCTCCACGCACCTGG - Intronic
903750175 1:25616684-25616706 CGCCGCCGCCGCGCCGCAGCCGG - Intergenic
903986965 1:27235143-27235165 CTCCGCCCCCACCCCGCCCCCGG - Intronic
920805641 1:209231627-209231649 CATCCCCTACCCGCCGCACCTGG - Intergenic
921361493 1:214334363-214334385 CACCTCCTTCATGCCTCACCAGG + Intronic
924527477 1:244864665-244864687 CCCCGCCCCCACGCCGAACCCGG + Intergenic
1066436304 10:35399256-35399278 CACAGCCTCCACGGCCCAGCAGG - Intronic
1067853243 10:49768759-49768781 CAGCCCCTCCCCGCCGCCCCAGG - Intergenic
1070598534 10:77849537-77849559 CACCACCTCCAGACCCCACCAGG - Intronic
1073099599 10:100999783-100999805 CTCCGCCTCCGCGGCGCCCCCGG - Exonic
1074772599 10:116743118-116743140 CACCGCCTCCAGGCCGCCTGCGG + Intergenic
1075678864 10:124318253-124318275 CACGGCCTCCAAACCCCACCTGG + Intergenic
1076774935 10:132690009-132690031 CACCGGCTGCACGGCTCACCTGG + Intronic
1076774957 10:132690090-132690112 CACCGGCTGCACGGCTCACCTGG + Intronic
1076857884 10:133126547-133126569 CACCGCCTCCAGCCCCCACCCGG - Intronic
1076893890 10:133299426-133299448 CACAGGCTCCACGCTGCAGCAGG - Exonic
1077176700 11:1194372-1194394 CACCCCCTCCGCGGCACACCGGG - Intronic
1077231853 11:1461293-1461315 CACCGCCTCCACGCCGCACCTGG + Exonic
1077359715 11:2135410-2135432 CACCAGCTCCCCGCCGCACAGGG + Exonic
1078246052 11:9573959-9573981 CGCCGCCACCCCGCCGCGCCGGG + Exonic
1081607240 11:44535143-44535165 CACCGACTCCAGCCCCCACCAGG - Intergenic
1081831625 11:46120435-46120457 CGCCCCCTCCCCGCCGCCCCCGG + Intronic
1083596249 11:63919417-63919439 CACCCCCTCCCTGCCGCCCCGGG + Intergenic
1083627495 11:64079062-64079084 CAGCGCCTCCCCACCGCCCCCGG - Intronic
1083661471 11:64253431-64253453 CACCGCCCCTACTGCGCACCAGG - Intronic
1084321077 11:68373663-68373685 CACCCCCTCCACACAGCCCCAGG + Intronic
1089134287 11:116236954-116236976 TACTGCCTCCACGCTGAACCTGG - Intergenic
1090204308 11:124876270-124876292 CACAGCGTCCCCGCCGGACCTGG + Exonic
1092429378 12:8396830-8396852 CACCGCCACCACGCCGGGCCCGG + Intergenic
1102109122 12:110351143-110351165 AAGGGCCTCCACTCCGCACCCGG + Intergenic
1103903457 12:124315358-124315380 CACCGCCTCCACTGGGCACTTGG - Exonic
1104978590 12:132562994-132563016 CACAGCCTGCACCCCACACCTGG + Intronic
1104978742 12:132563410-132563432 CACAGCCTGCACCCCACACCTGG + Intronic
1106592583 13:31110442-31110464 CTGAGCCTCCACCCCGCACCTGG + Intergenic
1107851797 13:44577969-44577991 CTCCTCCCCCTCGCCGCACCTGG + Intergenic
1111672458 13:91348052-91348074 CGCCGCCGCCACGCTGCCCCGGG - Intergenic
1112505195 13:99970982-99971004 CACCGGCTCCCCCCAGCACCCGG - Exonic
1113748515 13:112762819-112762841 CCCGGCCTCCACGCCACTCCTGG - Intronic
1113846325 13:113393893-113393915 CACCGTCCCCGCTCCGCACCAGG + Intergenic
1119472584 14:74909123-74909145 CACGGCCTCCCCGCAGCACTGGG + Exonic
1119484926 14:74980978-74981000 CATCCCCTCCACGACGCCCCAGG - Intergenic
1121649265 14:95545107-95545129 CAAAGCCTCCATGCCACACCAGG - Intergenic
1122316359 14:100828002-100828024 CAGCGCCTCCCGCCCGCACCAGG - Intergenic
1122998921 14:105281412-105281434 CACGGCCTCCACCTCACACCTGG - Intronic
1127467010 15:59253988-59254010 CAAGGCCTACACACCGCACCTGG - Intronic
1127868275 15:63048813-63048835 CCACGCCTCCAGGGCGCACCTGG + Intronic
1128171503 15:65517554-65517576 CGCCGCCTCCACTCCGGTCCTGG + Intronic
1129034903 15:72642958-72642980 CACCTCCCCCACCCCACACCAGG - Intergenic
1129214979 15:74094258-74094280 CACCTCCCCCACCCCACACCAGG + Intergenic
1129390388 15:75217341-75217363 CACCTCCCCCACCCCACACCAGG - Intergenic
1129488862 15:75904100-75904122 CTCCGCCTCCTCTCCTCACCAGG - Exonic
1129732123 15:77938620-77938642 CACCTCCCCCACCCCACACCAGG + Intergenic
1131263613 15:90902945-90902967 CCCGGCCTCCGCGCCGCTCCGGG - Intronic
1132055219 15:98647402-98647424 CACCCCCTCCTCGGCGCCCCGGG + Intergenic
1132534101 16:468309-468331 CACCGCCTCCCTGACGCCCCAGG - Intronic
1132975614 16:2709793-2709815 CACCCACTCCACCCCTCACCAGG - Intergenic
1133032529 16:3018081-3018103 CGCCGCCACCACCCTGCACCCGG + Intronic
1133212683 16:4272167-4272189 CCCCGCCCCCACCCCGCGCCGGG + Intronic
1139435810 16:66935854-66935876 CAACGCCTCCCCGCCGCCCAAGG + Intronic
1142413145 16:89926237-89926259 CACCGCCTCCTCGCGGCTGCGGG + Intronic
1143198798 17:5097835-5097857 CCCCGCCCCCCCACCGCACCGGG + Intergenic
1143750221 17:9022053-9022075 CGCCGCCCCCACGCCGCCCGAGG - Intronic
1144269144 17:13600938-13600960 CCCCGCCTCCTCGCCGCCGCCGG + Exonic
1146173143 17:30648206-30648228 TACCCCCTCCACCCCGCTCCAGG + Intergenic
1146912660 17:36658392-36658414 CACCTCCTCTACTCCTCACCAGG + Intergenic
1148648023 17:49230406-49230428 CACAGCCCCCACCCCGCGCCGGG + Intronic
1150747327 17:67825997-67826019 CCCCGCCTCCTCGCCCCCCCCGG - Exonic
1151399531 17:73846858-73846880 CACCACCTCCATGGAGCACCAGG - Intergenic
1152019532 17:77773113-77773135 CCCAGCCTCCACCCCTCACCTGG + Intergenic
1152226982 17:79097256-79097278 CCCCTCCTCCACGCCTCCCCCGG + Intronic
1152450359 17:80374731-80374753 CACAGCCTCCAGGGCGCACCTGG + Intronic
1152568792 17:81112208-81112230 CACCCCTTCCAAGCCTCACCAGG - Intronic
1153514423 18:5891148-5891170 CGCCGCGTCCCCGCCGGACCTGG - Exonic
1160786724 19:903526-903548 CACCGCAGCCACCCGGCACCTGG + Intronic
1160788726 19:913116-913138 CGCCGCCTCCGGGCCGCACTCGG + Exonic
1160860264 19:1234606-1234628 CTCAGCCACCACGCCCCACCCGG - Exonic
1161404557 19:4084259-4084281 CGGGGCCTCCAGGCCGCACCTGG - Intergenic
1161818516 19:6515324-6515346 CACAGCCCCCACCCCACACCAGG + Intergenic
1162421533 19:10568582-10568604 CACCTCCTGCACGTCGCCCCGGG + Exonic
1163523831 19:17808251-17808273 CACAGCCTCCAACCCGCACGAGG + Exonic
1163550360 19:17963153-17963175 GCCCGCCACCACGCCACACCCGG + Intronic
1164762138 19:30736177-30736199 CACCCCCTCCACTCACCACCAGG + Intergenic
1165809731 19:38605335-38605357 CACCCCCTCCCCACCCCACCAGG + Intronic
1166921447 19:46231527-46231549 CACCTCCTCCCCACCCCACCTGG - Intergenic
1167112744 19:47471712-47471734 AACCGCCCCCACTCCGCACCTGG + Intronic
1167491608 19:49795796-49795818 CTCCTGCTCCACGGCGCACCAGG + Intronic
926618994 2:15030058-15030080 CACAGCCTCCACAGCTCACCAGG + Intergenic
930730771 2:54725271-54725293 CAACCCCTCCCCGCCGCCCCTGG - Intronic
931515977 2:63050954-63050976 CACTGCCTCCACGTTGCACCGGG + Intronic
932599312 2:73112921-73112943 CGCCGCCTCCCCGCCTCACCGGG + Exonic
935684421 2:105670968-105670990 CACCCTCTCCACTCCCCACCAGG + Intergenic
935789992 2:106582195-106582217 CACCGCCTCCACCCCACGCATGG + Intergenic
937047022 2:118857278-118857300 CACCGCCTCCAGGCAGCACGCGG - Intergenic
937842507 2:126537836-126537858 CACCACCTGCACCCCCCACCTGG + Intergenic
942246377 2:174012729-174012751 CACCGCCTCCAGGGAGCCCCGGG - Intergenic
945648810 2:212536294-212536316 CACCCCCACCCTGCCGCACCTGG - Intronic
948132681 2:235612294-235612316 CACCGCCTCCACGCCACAGGAGG - Intronic
948200181 2:236124134-236124156 GCCCGCCTGCTCGCCGCACCTGG + Exonic
948381044 2:237550227-237550249 CACCGCCTCCCTGCAACACCTGG + Intronic
948421640 2:237863913-237863935 CACCACCTCCACCCCTCACGGGG + Intronic
948826637 2:240576274-240576296 CACCCACTCCACGCCTCTCCTGG - Intronic
1172295931 20:33811320-33811342 CTCCGCCTCCGCCCCGCAGCTGG - Exonic
1172751169 20:37252304-37252326 CACCACCTACAAGCAGCACCAGG - Intronic
1174264122 20:49318998-49319020 CACCGCCTGCGTCCCGCACCTGG - Intergenic
1175264619 20:57695211-57695233 CACCGCCTGCCCGCCTCACCTGG - Intronic
1175621243 20:60449276-60449298 CACTGCCTGCACGCCACTCCTGG + Intergenic
1179897185 21:44369517-44369539 CACCTGCTCCCCGCAGCACCCGG - Intronic
1179897203 21:44369575-44369597 CACCTGCTCCCCGCAGCACCCGG - Intronic
1179897221 21:44369635-44369657 CACCTGCTCCCCGCAGCACCCGG - Intronic
1179897255 21:44369753-44369775 CACCTGCTCCCCGCAGCACCCGG - Intronic
1179897273 21:44369813-44369835 CACCTGCTCCCCGCAGCACCCGG - Intronic
1179897291 21:44369873-44369895 CACCTGCTCCCCGCAGCACCCGG - Intronic
1179897309 21:44369931-44369953 CACCTGCTCCCCGCAGCACCCGG - Intronic
1180026166 21:45163534-45163556 CCCCACCTCCACCCTGCACCAGG + Intronic
1180041442 21:45282308-45282330 CACAGCCTCCAGGCTGCTCCCGG + Intronic
1180695607 22:17749857-17749879 CAGCCCCTCCACACCGCGCCTGG - Intronic
1180959695 22:19756982-19757004 CACCGCCTCCATCGCGCAGCAGG - Intronic
1182827339 22:33277182-33277204 GACCGCCACCACGCCTTACCGGG - Exonic
953925292 3:46979606-46979628 CACCGCCGCCCCGCCTCTCCTGG - Intronic
955916505 3:63912753-63912775 CACCGCCGCCACGGCGCACACGG + Exonic
957519675 3:81302222-81302244 CACCGCCTCCACTGCCCACATGG + Intergenic
964541334 3:157783020-157783042 CACCCCCTCCACTCTGCACAGGG + Intergenic
964720626 3:159764796-159764818 CACCACCGCCATGCCGCCCCCGG + Exonic
967754136 3:193149533-193149555 CACTGCCTCCCCGCAGCCCCAGG + Intergenic
967808620 3:193736662-193736684 CAGGGCCTGCACGCCACACCAGG - Intergenic
968066518 3:195762333-195762355 CACCACCCCCACCCCGCCCCTGG + Intronic
968081177 3:195847795-195847817 CCCCACCTCCAAGCCGGACCAGG + Intergenic
968452443 4:681756-681778 CGCCGCCCTCACCCCGCACCCGG + Intronic
968474250 4:795627-795649 CACCGCCTCCACCTCTCACGGGG - Intronic
975745706 4:77472405-77472427 CACTTCCTCCACTCCACACCTGG + Intergenic
978219863 4:106256733-106256755 CACCTCCTCCACACTGCAGCCGG + Intronic
980923928 4:139115420-139115442 CACCGCCTCCGGGACGCCCCCGG + Intronic
985629952 5:1009035-1009057 CGCCGCCGCCACGCCCCGCCGGG - Exonic
986451529 5:7869656-7869678 CACCGCCTCCGCGCCGCTTCCGG + Intronic
992528448 5:77633009-77633031 CACACCTTACACGCCGCACCGGG + Intronic
999764085 5:154725101-154725123 CACCGCATCCAGCCCACACCTGG - Intronic
1002670363 5:180861433-180861455 CACGGCCTCCTGGCCGCGCCTGG - Intergenic
1004396339 6:15248819-15248841 CCCCGCCGCCCCGCCGCGCCTGG - Intronic
1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG + Exonic
1006196238 6:32244234-32244256 CACCTCCTCCACTCCCCACCAGG + Intergenic
1006309726 6:33249219-33249241 CACCGCCTCCGCGTTGCTCCGGG - Intergenic
1007585087 6:42984564-42984586 CACCGCCTGCGCGCTGCGCCCGG - Exonic
1013227939 6:108134024-108134046 CACCGCCTCGCCGCCGCAGGAGG - Intronic
1014761712 6:125363903-125363925 CACCGCCTTCACGCAACTCCAGG + Intergenic
1019079381 6:169419815-169419837 CACCTCCTCCTCCCCGCACAGGG - Intergenic
1019406296 7:885899-885921 GACCCCCTCCACGCAGCACCTGG + Intronic
1019571577 7:1715349-1715371 TTCCGCCTCCACCCCACACCTGG + Intronic
1019746922 7:2705895-2705917 CACCTCCCCCACGCCGTACACGG + Intronic
1021998396 7:26201802-26201824 CACCGCCTCCGAGCTGCTCCGGG - Intronic
1022687303 7:32608855-32608877 CACTGCCTCCACTGCTCACCAGG - Intergenic
1024920293 7:54546766-54546788 CACCGCCCCCACGCTGTCCCTGG - Intronic
1025829787 7:65038706-65038728 CCCCGCCGCCACCCCCCACCCGG - Intergenic
1029075075 7:97928487-97928509 CACCTCCGCCACGCCGGGCCCGG + Intergenic
1029351412 7:100015696-100015718 CAGCGCCCCCAGGCCGCTCCCGG + Exonic
1029736528 7:102468575-102468597 CACAGCCTCCCCGCCGCACGTGG - Exonic
1032913987 7:136466566-136466588 CAACGCCTCCACTCCCCATCAGG + Intergenic
1034426453 7:151016669-151016691 CTCAGCCTCCACTCCTCACCTGG + Exonic
1035261014 7:157661688-157661710 CACCTCCTCCACCCAGGACCCGG - Intronic
1036392120 8:8332633-8332655 CACCACCTCCAGGCCACTCCAGG + Intronic
1036900433 8:12665685-12665707 CACCGCCGCCACGCCGGGCTCGG + Intergenic
1037305143 8:17496999-17497021 CACCGCCTCCTCCGCGCTCCCGG - Intergenic
1037992129 8:23328538-23328560 CACCGCCTCTCAGTCGCACCAGG + Exonic
1038266964 8:26045325-26045347 CACCGCCTCCTCTCGGCTCCAGG - Exonic
1040817154 8:51520417-51520439 CAATCACTCCACGCCGCACCAGG + Intronic
1050356980 9:4792855-4792877 CCCCGCCTCCCCGCCCGACCGGG - Exonic
1052360077 9:27544885-27544907 CACCGCCTCTCCCCAGCACCTGG + Intergenic
1052784724 9:32817775-32817797 CACAGCCTCCTCCCAGCACCGGG + Intergenic
1058525133 9:105850005-105850027 CCCCTCCTCCCCGCCGCCCCAGG - Intergenic
1059906324 9:118990810-118990832 CACTGCCTCCATTCCTCACCTGG - Intergenic
1060263141 9:122093092-122093114 CACCGCCTCCGCCTCCCACCGGG + Exonic
1060826752 9:126692126-126692148 CACTGCCTCCACGCAGGCCCTGG - Intronic
1062022491 9:134326142-134326164 CGCCGCCTCCTCGCGGCTCCCGG + Intronic
1062220502 9:135412695-135412717 CACCGGCTCCCCGCCGCTCCGGG + Intergenic
1062579423 9:137222787-137222809 GGCCGCCTCCACCCCGCACTGGG - Intergenic
1190559275 X:51671168-51671190 CACCACCTCCAGGCCTCACTGGG - Intergenic
1190565016 X:51722153-51722175 CACCACCTCCAGGCCTCACTGGG + Intergenic
1198001290 X:132440193-132440215 CTCCACCTCCCCGCCGAACCTGG - Intronic
1200069175 X:153519343-153519365 CCCCGCCTCCCTGCCCCACCAGG - Intronic