ID: 1077233743

View in Genome Browser
Species Human (GRCh38)
Location 11:1470144-1470166
Sequence ACGTGTGCCCCTGTCCGGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077233740_1077233743 -6 Left 1077233740 11:1470127-1470149 CCACCGTCTCTTTGCACACGTGT 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1077233743 11:1470144-1470166 ACGTGTGCCCCTGTCCGGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 115
1077233741_1077233743 -9 Left 1077233741 11:1470130-1470152 CCGTCTCTTTGCACACGTGTGCC 0: 1
1: 0
2: 0
3: 22
4: 205
Right 1077233743 11:1470144-1470166 ACGTGTGCCCCTGTCCGGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077233743 Original CRISPR ACGTGTGCCCCTGTCCGGCC CGG Exonic
900600040 1:3498981-3499003 ACCTGTGCCCCTCTCCAGGCAGG - Intronic
900983793 1:6061358-6061380 GCGTGAGCCCCCGCCCGGCCCGG - Intronic
907373592 1:54018284-54018306 AGGAGGGCCCCTCTCCGGCCAGG + Intergenic
914004624 1:143721499-143721521 GCGTGAGCCACTGTCCGTCCCGG - Intergenic
914203387 1:145505942-145505964 CCGTGGGCTCCTGTGCGGCCGGG - Intergenic
914482509 1:148079096-148079118 CCGTGGGCTCCTGTGCGGCCGGG - Intergenic
919466505 1:197926659-197926681 AGCTGTGCCCCTGGCTGGCCTGG - Intronic
919767591 1:201137170-201137192 ACGTGTGGCCATGTCAGGCAGGG + Intronic
922714473 1:227859791-227859813 CCGTGTGCCCCTGTGGGGCCTGG - Intergenic
922722145 1:227904633-227904655 GCAGATGCCCCTGTCCGGCCGGG + Intergenic
1070912015 10:80127119-80127141 ACTTGTGCCCCGGCCCAGCCAGG + Intergenic
1075391604 10:122096399-122096421 AAGAGTGCCCCTTACCGGCCAGG + Intronic
1076283598 10:129272366-129272388 GGGTGGGCCCCTATCCGGCCTGG + Intergenic
1076333798 10:129691622-129691644 ACCTGTGCCACTGCCAGGCCTGG - Intronic
1076671358 10:132122518-132122540 AGGTGTGGCCCTGCCCGGCTGGG - Intronic
1076733301 10:132448692-132448714 ACCCTTGCCCCAGTCCGGCCCGG + Exonic
1076733330 10:132448754-132448776 ACCCTTGCCCCAGTCCGGCCCGG + Exonic
1076733444 10:132449002-132449024 ACCCTTGCCCCAGTCCGGCCTGG + Exonic
1076733458 10:132449033-132449055 ACCCTTGCCCCAGTCCGGCCTGG + Exonic
1076733472 10:132449064-132449086 ACCCTTGCCCCAGTCCGGCCTGG + Exonic
1076733533 10:132449217-132449239 ACCCTTGCCCCAGTCCGGCCTGG + Exonic
1076733547 10:132449248-132449270 ACCCTTGCCCCAGTCCGGCCTGG + Exonic
1077233743 11:1470144-1470166 ACGTGTGCCCCTGTCCGGCCCGG + Exonic
1077286002 11:1766260-1766282 TCGTGTGCCCTGGTCCTGCCTGG + Intergenic
1091778524 12:3199916-3199938 ACTTGGGGGCCTGTCCGGCCAGG - Intronic
1095049390 12:37543137-37543159 ACTTGTGCCCCTCTTCAGCCGGG + Intergenic
1101529982 12:105564871-105564893 AGTTGTTCCCCTGTCAGGCCAGG + Intergenic
1101657555 12:106736544-106736566 ACGTGTGCCACCTTCAGGCCAGG - Intronic
1103704305 12:122863013-122863035 ACGTGTTCCCTTGTCGGCCCTGG + Intergenic
1114042659 14:18693197-18693219 ACTTGTGCCCCGGCCCAGCCAGG + Intergenic
1122823481 14:104358708-104358730 AAGTGAGCCCCTGCCCGGCCTGG - Intergenic
1125749645 15:42019834-42019856 GCATCTGCCCCTGTCAGGCCTGG - Intronic
1129336044 15:74852783-74852805 AGGTGTGGCCCTGCCCTGCCTGG + Intronic
1130128835 15:81118635-81118657 GCGTGTGCGCTGGTCCGGCCTGG - Intronic
1130883592 15:88075288-88075310 ACGTCAGCCCCTGTCTAGCCGGG + Intronic
1132869285 16:2108539-2108561 GCGTGTGGCCCTGCCCGGCGTGG - Exonic
1133246816 16:4454710-4454732 ACGTGGGCCCCTGGGTGGCCAGG + Intronic
1133306358 16:4812058-4812080 ACGCCTGCACCTGTCAGGCCTGG - Intronic
1134247883 16:12553484-12553506 AAGTGTGCACCTGCCCTGCCTGG - Intronic
1134550337 16:15135936-15135958 GCGTGTGGCCCTGCCCGGCGTGG - Intronic
1134718129 16:16367059-16367081 GCGTGTGGCCCTGCCCGGCGTGG + Intergenic
1134956623 16:18385100-18385122 GCGTGTGGCCCTGCCCGGCGTGG - Intergenic
1139509294 16:67417287-67417309 GCGTGAGCCCCTGCCCGGCCGGG + Intergenic
1141963292 16:87423947-87423969 ACGTGTGCCCCAGTCGTACCAGG - Intronic
1143104364 17:4521183-4521205 AAGTTTCCCCCTGTCTGGCCAGG - Intronic
1143335610 17:6169570-6169592 ACCTGTGCCCCACTCCAGCCAGG + Intergenic
1143395816 17:6595169-6595191 ACATGGGCACCTGTCAGGCCAGG + Intronic
1145055649 17:19702272-19702294 ACCTGTGCCCCAGGCTGGCCAGG - Intronic
1146254921 17:31386355-31386377 AAGTGTGCCCTAGTCCAGCCAGG + Intergenic
1147327350 17:39675842-39675864 CCTAGTGCCCCTGTCTGGCCTGG + Intronic
1147740860 17:42670253-42670275 GCGGGTGCCCCTGCCCCGCCTGG - Exonic
1147994504 17:44353612-44353634 CCCTGGGCCCCTCTCCGGCCTGG + Exonic
1148138244 17:45309606-45309628 ACACGTGTCCCTGTCCAGCCAGG - Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151550441 17:74819625-74819647 AGGTGTGCCCAAGTCAGGCCCGG + Intronic
1152781576 17:82229339-82229361 TCGTCTCCCCCGGTCCGGCCCGG + Intronic
1154177652 18:12095187-12095209 GCGTGTGCCCATGGCCGTCCAGG + Exonic
1155208437 18:23580595-23580617 ACTTGTGCCCCTGTCCTGGATGG + Intronic
1157572738 18:48723705-48723727 ACCTGTGCCCCTGTCTCTCCTGG - Intronic
1162665107 19:12203661-12203683 ACGTGAGCCACTGCCCAGCCTGG + Intergenic
1163273134 19:16266293-16266315 AAGTGAGCCCCTGTCAGGCCTGG - Intergenic
1164753573 19:30673267-30673289 ATGTGTGCCCCTGAAGGGCCAGG - Intronic
1165741126 19:38205956-38205978 ATGTGTGCCCCGGCCTGGCCTGG + Intronic
1165777472 19:38413220-38413242 CAGTGTGACCCTGTCCGGCTTGG + Exonic
1166304757 19:41931382-41931404 ACGTGTGCCCCTGCCGGCCGCGG - Intergenic
1166541153 19:43607051-43607073 GTGTGTGCCCCTGGCAGGCCAGG + Intronic
928963835 2:36957305-36957327 ACGTGAGCCACTGCCAGGCCTGG - Intronic
936460872 2:112713066-112713088 ACGTGTGCCCCCCTCCGGCCAGG + Intergenic
938086410 2:128405022-128405044 ACGGGGGCCCCTGACCAGCCAGG - Intergenic
938267508 2:129939048-129939070 ACTTGTGCCCCGGCCCAGCCAGG - Intergenic
942140570 2:172973481-172973503 ACCTGTGCCCCTATCTGGCTAGG - Intronic
948137230 2:235645610-235645632 CTGTGTGCCCCTGCCAGGCCTGG - Intronic
948287707 2:236799310-236799332 GCGTGTGTCCCTGGCAGGCCTGG - Intergenic
1172115039 20:32568680-32568702 GCCTGTGCCCCTGCCCGACCTGG + Intronic
1172644464 20:36461354-36461376 GCGCGCGCCCCTGCCCGGCCCGG + Intronic
1173405185 20:42758329-42758351 ACCTGTGCCCCTCTCCTGACAGG - Intronic
1173580014 20:44140494-44140516 TCGTGTGGCCCTGTCTGGCAAGG - Intronic
1178544205 21:33479736-33479758 TCGTCGGGCCCTGTCCGGCCCGG - Intronic
1180066988 21:45417516-45417538 ACGGGTGCCCCCGCCCTGCCTGG + Intronic
1181283470 22:21735974-21735996 ACGTGGGCTCCTGCCCGTCCCGG - Intergenic
949259016 3:2083916-2083938 CCGTGGGCTCCTGTGCGGCCCGG + Intergenic
952287438 3:31981729-31981751 GCGTGTGAGCCTGTCAGGCCGGG - Intronic
953929865 3:47000490-47000512 AGGTGTGGCCCTGTCTGACCAGG + Intronic
968181553 3:196599108-196599130 CCGTGGGCTCCTGTGCGGCCCGG - Intergenic
968921892 4:3526626-3526648 ACGTGTGCCCCTGCGCGGCGCGG - Intronic
968956086 4:3720343-3720365 ACGTGTGGCCCTGGGAGGCCTGG - Intergenic
969346482 4:6573761-6573783 ACATGTCCCCATGACCGGCCAGG - Intergenic
976693542 4:87894076-87894098 TCGAGTGCCCCTGTCCCACCTGG + Intergenic
977960230 4:103076581-103076603 ACGTGGGCCCATGGTCGGCCTGG - Exonic
984445993 4:179836463-179836485 ATGTTTGCCCCTGTCTGGCAAGG - Intergenic
984529947 4:180903441-180903463 ACTTGTGCACCTGTACAGCCAGG + Intergenic
984844777 4:184100178-184100200 ACCTGTGCACCTGACCCGCCAGG - Intronic
985643383 5:1074065-1074087 ACCTGTTCTCCTGTCCTGCCTGG - Intronic
985881957 5:2645169-2645191 ACCTGTGACCCTGTCCTCCCGGG + Intergenic
998037083 5:138926481-138926503 ACCTGTGCCCCTGTCCTGTTTGG + Intronic
1003573038 6:7268506-7268528 ACGTGTGGCACTGCTCGGCCTGG + Intronic
1007780844 6:44253665-44253687 TCGAGTGCCCCTGTCCCACCTGG + Exonic
1013562357 6:111318408-111318430 AGGTGTGACCGTGCCCGGCCAGG + Intronic
1015693811 6:135957142-135957164 AGGTGTGCCTGGGTCCGGCCAGG + Intronic
1018901147 6:168052386-168052408 ACGTGTTCCCATGTCCGCTCAGG + Intergenic
1019338280 7:495228-495250 AGCTGTGCCCCTGGCAGGCCCGG - Intergenic
1019505316 7:1387544-1387566 GCGTGAGCCACTGCCCGGCCGGG - Intergenic
1021897932 7:25255166-25255188 ACGTGTGCCACTTCCAGGCCTGG - Intergenic
1021969336 7:25951316-25951338 ACGTGCGCCCCGGGCGGGCCCGG + Intergenic
1024585872 7:50841927-50841949 GCGTGCGCTACTGTCCGGCCTGG + Intergenic
1025295300 7:57771731-57771753 ACTTGTGCCCCTCTTCAGCCGGG + Intergenic
1026000427 7:66556553-66556575 ACGTGCGCCCCGGCCCAGCCTGG + Intergenic
1029462954 7:100706716-100706738 GCGTGAGCCACTGCCCGGCCAGG + Intronic
1034976792 7:155453811-155453833 ACGCGCGCCCCTGGCAGGCCTGG + Intergenic
1035062792 7:156081559-156081581 ACGTGTGCACTTGTCCTGCCTGG + Intergenic
1035244710 7:157554405-157554427 CGTTGTGCCCCTGCCCGGCCTGG - Intronic
1035742977 8:1943186-1943208 GCCTGTGCCCCTTTCCGGCTGGG - Intronic
1049255637 8:141612230-141612252 ACCTGTGGCCCTGTCTGGGCTGG + Intergenic
1049685619 8:143938126-143938148 ACGTGTGCCCCTGCCCCCTCCGG - Intronic
1049755857 8:144311051-144311073 AAGTGTGACCATGTCTGGCCTGG - Intronic
1049796497 8:144499558-144499580 TCGAGTGCCCCTGTGAGGCCGGG + Intronic
1052032056 9:23639983-23640005 ATGTGTGCCACTTTCAGGCCAGG + Intergenic
1056756599 9:89385720-89385742 AAGAGGGCCCCTGTCTGGCCGGG - Intronic
1060404476 9:123366407-123366429 AGGTGTGCGCCTGTGCGGCCTGG + Intronic
1062119785 9:134828058-134828080 ACGTGAGCCCCAGTCAGTCCAGG + Intronic
1062394191 9:136346122-136346144 ACGTGTGCCTCTGGCCGCACAGG + Intronic
1062458680 9:136653764-136653786 GCGTCTGCCCCTGTCCTTCCCGG + Intergenic
1062547462 9:137070123-137070145 ACGCGCGCCCCGGCCCGGCCCGG - Exonic
1198302437 X:135344978-135345000 CGGTGGGCCCCTATCCGGCCAGG + Intronic