ID: 1077235311

View in Genome Browser
Species Human (GRCh38)
Location 11:1479304-1479326
Sequence AGGCATGGAGATGGGTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 565}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077235311 Original CRISPR AGGCATGGAGATGGGTCCTG AGG (reversed) Intronic
900241951 1:1621405-1621427 AGACAAGGAGAGGGGTCCCGTGG - Intronic
900342882 1:2197086-2197108 AGGGAAGGAGATGGGTCCCAGGG - Intronic
900422185 1:2560453-2560475 AGTCTTGGAGGTGGGGCCTGGGG - Intronic
900948585 1:5844961-5844983 AGATATGGAGTTGGGACCTGCGG + Intergenic
901607265 1:10469013-10469035 AGACATGGTGCTGAGTCCTGGGG - Intronic
902045491 1:13520887-13520909 AGGCATTGAACTGGGTCCCGGGG + Intergenic
902188208 1:14741266-14741288 AGGCATGGTGCTGGGTGCTGGGG - Intronic
902437855 1:16409699-16409721 AGGCATGGAGGTGGGGACCGGGG + Exonic
902622766 1:17660091-17660113 AGGCATGCAGCAGGGTGCTGGGG + Intronic
904921675 1:34013105-34013127 AGGCACTGAGATGGGAGCTGAGG + Intronic
904999814 1:34659384-34659406 AGGTATGGTGCTGGGTGCTGGGG - Intergenic
905652239 1:39664291-39664313 GGGCATGGTGGTGGGGCCTGTGG - Intronic
905769154 1:40626155-40626177 AGGGATGGAGGTGGGGCATGCGG - Exonic
906606404 1:47175432-47175454 GGGCATGGAGATGTGTGGTGAGG + Intergenic
907023267 1:51089315-51089337 AAGGTTGGAGATGGGGCCTGTGG - Intergenic
907120864 1:52006825-52006847 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
907241337 1:53082819-53082841 AGGCATGCAAATGTGTCATGGGG - Intronic
908659983 1:66425179-66425201 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
909413226 1:75377667-75377689 AGGGCTGGAGGTGGGACCTGCGG + Intronic
909413877 1:75383072-75383094 AGGGCTGGAGGTGGGACCTGCGG + Intronic
909651745 1:77983234-77983256 AGGGCTGGAGGTGGGACCTGCGG - Intronic
911010613 1:93277146-93277168 AGGGCTGGAGGTGGGACCTGCGG - Intronic
914393227 1:147240678-147240700 AGGCCTGGAGGTGGGACATGTGG + Intronic
914946256 1:152069262-152069284 ACACAGGGAGATGGGTCGTGAGG - Intergenic
915128529 1:153681640-153681662 GGGCATGGAGGTGGGAGCTGTGG - Intronic
915162665 1:153931048-153931070 AGCCAAGGAGATGGGGCCTGGGG + Exonic
915401762 1:155627030-155627052 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
915402667 1:155635242-155635264 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
915480276 1:156179804-156179826 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
916092173 1:161316047-161316069 AGGGCTGGAGATGGGACATGTGG - Intronic
917088377 1:171327296-171327318 AGGCATTAAGATGGGTCCAATGG - Intronic
917611736 1:176695703-176695725 AGGGATGGAGATGGGAGATGAGG - Intronic
917961049 1:180144947-180144969 AGTCAGGGAGATGGGTCATCCGG - Intergenic
918339142 1:183552884-183552906 AGGGATGGAGATGGGGCAGGAGG - Intronic
919303888 1:195805515-195805537 AGCCAGGGACATGGGTCCAGAGG + Intergenic
920231782 1:204475500-204475522 AGACATGGAGATGGGTGGTCAGG + Intronic
920721180 1:208388450-208388472 AGGGATGGAGATTTCTCCTGAGG + Intergenic
921740101 1:218674540-218674562 AGGCAGAGAGGTGGGTCATGGGG - Intergenic
922305452 1:224340412-224340434 AGGGCTGGAGGTGGGACCTGTGG + Intergenic
923288296 1:232518709-232518731 AGGCATGGAAATGGGTGTTTGGG - Intronic
924569472 1:245225280-245225302 AACCAAGGAGAAGGGTCCTGGGG + Intronic
1063156437 10:3383457-3383479 GGACATGGAGATGGGTCTCGGGG + Intergenic
1063810311 10:9697436-9697458 AGTGATGGAGGTGGTTCCTGAGG + Intergenic
1064158546 10:12923739-12923761 AGGCATGGAGACGGGTCGGGAGG - Intronic
1065553783 10:26894051-26894073 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1065865460 10:29911199-29911221 AGGCATGGAGGTGGAGTCTGAGG - Intergenic
1066438508 10:35415504-35415526 GGAGATGGAGCTGGGTCCTGAGG + Intronic
1066695891 10:38077171-38077193 AGGCAGGGAGCAGTGTCCTGAGG + Intergenic
1066927302 10:41713767-41713789 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1066996649 10:42570389-42570411 AGGCAGGGAGCAGTGTCCTGAGG - Intergenic
1067101479 10:43337785-43337807 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1068734385 10:60395676-60395698 AGGCATGAAGATATGTCCTCAGG + Intronic
1069452123 10:68526250-68526272 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1069577925 10:69543973-69543995 AGGCAGGGAGATTGGAACTGGGG + Intergenic
1069750895 10:70744301-70744323 AGGCCTGGAGATGGGCCCCAGGG - Intronic
1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG + Intronic
1070529663 10:77325612-77325634 AGGAATGGGGATGGGCCCAGTGG - Intronic
1071297762 10:84234495-84234517 AGGCAAGGAGCTGGGTCCAGAGG - Intronic
1071569977 10:86691471-86691493 AGGGCAGGAGATGGATCCTGAGG + Intronic
1071923136 10:90374196-90374218 AGGCACTGAGCTGGGTTCTGTGG - Intergenic
1072039630 10:91594578-91594600 AGCCATGGAAATGGTCCCTGTGG + Intergenic
1072165627 10:92810090-92810112 AGGCATGGAGGTGCATGCTGTGG + Intergenic
1072564507 10:96606422-96606444 AGTCATGGAGCTGGTGCCTGTGG - Intronic
1072669239 10:97417198-97417220 AGGGCTGGAGATGGGACATGCGG - Intronic
1074153039 10:110775561-110775583 AGGCATGGGGATGGGATTTGAGG - Intronic
1074403430 10:113161112-113161134 ACACATGGAGAAGGGTTCTGGGG + Intronic
1075122895 10:119677123-119677145 AATCATGGAGATGGGTGCCGTGG + Exonic
1075701778 10:124474645-124474667 TGGTTTGGAGATGGGACCTGTGG - Intronic
1075776699 10:124993801-124993823 AGGTGTGGAGCTGGGCCCTGTGG + Intronic
1075781835 10:125022272-125022294 AGGCACCAAGATGGGGCCTGTGG - Intronic
1076249952 10:128977764-128977786 AGGCATGGAGATGGGGCAGCTGG + Intergenic
1077235311 11:1479304-1479326 AGGCATGGAGATGGGTCCTGAGG - Intronic
1077507825 11:2940321-2940343 ACGCCTGGAGATGGGGCCTCAGG - Intergenic
1077610442 11:3640417-3640439 AGCACTGGACATGGGTCCTGGGG + Intronic
1078327368 11:10391673-10391695 AGGGCTGGAGGTGGGACCTGCGG - Intronic
1078384843 11:10880500-10880522 AGCAATGGGGATGGGTCTTGAGG - Intergenic
1078450357 11:11436355-11436377 TGGCAAGGGGATGTGTCCTGTGG - Intronic
1078877823 11:15415726-15415748 TGGCAAGCAGATGGGTCGTGGGG - Intergenic
1079299211 11:19262524-19262546 GGGCATGGAGCTGGGCACTGGGG - Intergenic
1079770017 11:24446667-24446689 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1081065781 11:38537333-38537355 GGTCACGGAGATGGCTCCTGAGG + Intergenic
1083008042 11:59367498-59367520 TGGCATGGAAGTGGGGCCTGTGG - Intergenic
1083543378 11:63530678-63530700 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1083785571 11:64944104-64944126 AGGCATTGTGTTGGGTGCTGGGG - Intronic
1083812145 11:65112074-65112096 GGGCAGAGAGATGGGACCTGGGG + Intronic
1083961622 11:66017802-66017824 AGGCATGAAATTGGGTTCTGAGG + Intronic
1084207369 11:67603718-67603740 AGGGCTGGAGGTGGGACCTGCGG - Exonic
1084240353 11:67815527-67815549 AGGCATGGTGGTGGGTGCCGAGG - Intergenic
1084247358 11:67868328-67868350 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1084308830 11:68304200-68304222 AGGCAGGGAGCAGTGTCCTGAGG - Intergenic
1084462907 11:69306274-69306296 AGGCACAGAGTTGGGTGCTGCGG + Intronic
1084650809 11:70488182-70488204 AGGCATGGTAAGGGCTCCTGGGG + Intronic
1084830740 11:71767309-71767331 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1084832087 11:71777318-71777340 AGGCATGGTGGTGGGTGCCGAGG + Intergenic
1084880131 11:72164955-72164977 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1085265374 11:75235087-75235109 AGGCAGGAAGTTGGGGCCTGAGG - Intergenic
1085526948 11:77169688-77169710 AGGCATTGTCATGGGTCTTGGGG + Intronic
1085571094 11:77558658-77558680 AGGCATGGTGTTGGGAACTGAGG - Intronic
1085603616 11:77877870-77877892 AGGCATGGGGCTGGGGGCTGTGG - Intronic
1087346892 11:96982915-96982937 ATGAATGCAGATGGGGCCTGGGG - Intergenic
1087723765 11:101695644-101695666 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1087724696 11:101704142-101704164 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1088668629 11:112119608-112119630 AGGCACTGTGCTGGGTCCTGGGG + Intronic
1089134994 11:116241901-116241923 GGGCAAGGGTATGGGTCCTGGGG - Intergenic
1089325666 11:117655140-117655162 GGGCATGGAGATGGCAGCTGGGG - Intronic
1089502230 11:118939557-118939579 TGCCATGGTGATGGGTCCAGAGG + Intronic
1089582305 11:119489101-119489123 AGGCATGGAGTGGGGACCTACGG + Intergenic
1089659638 11:119977640-119977662 AGGAATGGAGTAGGGGCCTGGGG + Intergenic
1089681316 11:120120491-120120513 GGGCATAGAGGTGGGTCCAGGGG - Intronic
1089830347 11:121321859-121321881 AGGGATGGAGATGGCTCTTCTGG + Intergenic
1090920062 11:131199188-131199210 AGGCATGGCCGTGGGTTCTGTGG - Intergenic
1092000565 12:5028416-5028438 AGGCACTGAGCTGGGTCTTGGGG + Intergenic
1092249651 12:6886218-6886240 AGGGCTGGAGGTGGGACCTGCGG - Intronic
1092410585 12:8250083-8250105 AGGCATGGTGGTGGGTGCCGAGG - Intergenic
1093097624 12:14989824-14989846 TGCCATGGACATGGGGCCTGTGG - Intergenic
1094001079 12:25694993-25695015 AGGCATTAAGATAGGTGCTGGGG - Intergenic
1094389322 12:29932418-29932440 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1094575859 12:31684791-31684813 AAGAATGTAAATGGGTCCTGGGG + Intronic
1094623251 12:32100092-32100114 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1096070662 12:48773853-48773875 AGGCCTGGTGATGGGCGCTGGGG - Intronic
1096079540 12:48824426-48824448 ATGCATGGTGACGTGTCCTGTGG - Intronic
1096106106 12:48997831-48997853 AGGCACCGAGATAGCTCCTGCGG - Exonic
1096267407 12:50134753-50134775 AGGGATGAAGCTGAGTCCTGGGG + Intronic
1096420653 12:51454651-51454673 AGGGCTGGAGGTGGGACCTGCGG - Intronic
1096551973 12:52378894-52378916 AGGCATGGAGTTGTGTCCAAGGG - Intronic
1096612924 12:52814827-52814849 AGGCATGGAGCTAGGTACTAAGG + Intergenic
1096827880 12:54293326-54293348 AGGTATGGAGCTGGGGCTTGGGG + Exonic
1096940086 12:55334012-55334034 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1097076762 12:56400725-56400747 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1097185132 12:57192676-57192698 GGGCATGGGGATGGCTGCTGTGG - Intronic
1097330483 12:58327823-58327845 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1097331419 12:58336312-58336334 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1098518235 12:71403211-71403233 AGGAATGAAGATGGCACCTGTGG + Intronic
1099879463 12:88450295-88450317 TGGAATGTAGATGGTTCCTGGGG - Intergenic
1101520613 12:105478923-105478945 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1101646307 12:106633867-106633889 AGGCAAGGAACTGGGACCTGGGG - Intronic
1101739009 12:107485343-107485365 AGGGAAGGATAGGGGTCCTGAGG - Intronic
1102122241 12:110450489-110450511 CAGAATGGAGATGGGTCTTGAGG + Intergenic
1102135489 12:110570619-110570641 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1102162596 12:110781750-110781772 AGGCATGGTGACGGGACCTGCGG + Intergenic
1103092403 12:118106557-118106579 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1103369609 12:120408822-120408844 AACCAAGGAGATAGGTCCTGTGG + Intergenic
1103772058 12:123335049-123335071 GGGCATGGTGGTGGGACCTGTGG + Intronic
1103882735 12:124178812-124178834 AGGCAAGGAGAGAGGTCTTGGGG + Intronic
1103924251 12:124414862-124414884 AAGCATGGACAAGTGTCCTGGGG + Intronic
1103980288 12:124732655-124732677 AGGTATGGAGCTGGGGCCAGGGG + Intergenic
1104513856 12:129405528-129405550 AGGCATGGAGGTGGGTCGGGAGG + Intronic
1105349167 13:19600799-19600821 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1105521417 13:21134603-21134625 AGGCATGGTGGTGTGGCCTGTGG + Intergenic
1105971700 13:25434722-25434744 ATGCATGGGGCTGGGTGCTGGGG - Intronic
1106684974 13:32049091-32049113 AGGCATTGTGCTGGGACCTGGGG + Intronic
1106866579 13:33970794-33970816 AGCCATTGAGAAGGGTCTTGTGG + Intergenic
1107835447 13:44409394-44409416 AGGCACTGAGCTGGATCCTGGGG + Intergenic
1108116768 13:47137328-47137350 AGGCATCAAGATGGGTGGTGGGG - Intergenic
1108910944 13:55550866-55550888 ATGCATGGTGCTGTGTCCTGAGG - Intergenic
1113428473 13:110229592-110229614 TGGCATGGAGGTGGGGCCTTGGG + Intronic
1114032050 14:18586685-18586707 AGGCATGCACATTGGGCCTGGGG + Intergenic
1114076830 14:19165715-19165737 AGGCATGCACATTGGGCCTGGGG + Intergenic
1114085331 14:19233853-19233875 AGGCATGCACATTGGGCCTGGGG - Intergenic
1114339057 14:21723893-21723915 AAGCATCGAGATGGGTGCAGAGG - Intergenic
1115070505 14:29316877-29316899 AGTGATGGCGGTGGGTCCTGAGG - Intergenic
1115761492 14:36581907-36581929 AGGCATGGAGAGGGGGCGGGGGG + Intronic
1117365666 14:55025117-55025139 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1118352001 14:64978952-64978974 AGGGCTGGAGGTGGGACCTGCGG - Intronic
1119404144 14:74386189-74386211 AGGCAAGAAGAGAGGTCCTGGGG + Intergenic
1119549447 14:75497677-75497699 AGGCATTGTAATGGGTACTGAGG + Intergenic
1119951370 14:78749196-78749218 ATGGATGGACATGGGCCCTGTGG + Intronic
1121307814 14:92917897-92917919 TGGGATGGAGTTGGGTGCTGGGG + Intergenic
1122262048 14:100529266-100529288 AGTCCTGGACATGGGCCCTGGGG + Intronic
1123039214 14:105483541-105483563 GGGCAGGGAGGTGGGCCCTGGGG + Intergenic
1123050760 14:105540894-105540916 AGGCAGGGAAATGGTTCCCGAGG - Intergenic
1202896895 14_GL000194v1_random:15561-15583 AGGCATGCACATTGGGCCTGGGG - Intergenic
1202891482 14_KI270722v1_random:163301-163323 AGTGTTGGAGGTGGGTCCTGGGG + Intergenic
1124202962 15:27694052-27694074 AGTGTTGGAGATGGGGCCTGGGG + Intergenic
1124996136 15:34724537-34724559 AGGCATGGAGATCTCACCTGGGG - Intergenic
1125404906 15:39341992-39342014 AGGCATGGAGCTAGATACTGAGG + Intergenic
1126672749 15:51131353-51131375 AGGAAGGGAGATGATTCCTGTGG + Intergenic
1128130973 15:65226906-65226928 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1128243296 15:66116083-66116105 AGGCATGGAGGTGGGCGGTGAGG - Intronic
1128451304 15:67807317-67807339 AGGCATTGGGATGGGTCCCATGG + Intergenic
1128538940 15:68511561-68511583 AGTCATGGAGATAGCTCCTGGGG + Intergenic
1128891003 15:71331713-71331735 AGTCCTGGAGATGGGCCCTGAGG - Intronic
1128945151 15:71814741-71814763 TGGCATGGCCATGGGTCCAGAGG + Intronic
1129122521 15:73409529-73409551 AGGCATGCAGACAGCTCCTGGGG - Intergenic
1129411356 15:75352241-75352263 AGGCATGGGCATGGGGACTGCGG + Intronic
1129697581 15:77749381-77749403 AGGCCTGGAGATGGGGCTGGTGG - Intronic
1129742514 15:77996342-77996364 AGGAATGGGGCTGGGCCCTGAGG - Exonic
1129890516 15:79068843-79068865 AGGCATGGCACTGTGTCCTGGGG + Intronic
1129940646 15:79494170-79494192 AGGCATGGAGGTGGGGCCATGGG + Intergenic
1130620225 15:85454102-85454124 TGCCATGGAAGTGGGTCCTGTGG + Intronic
1130944550 15:88541133-88541155 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1131200229 15:90389293-90389315 AGGTAAGGAGAAGGGGCCTGGGG + Intronic
1131968813 15:97872143-97872165 ATGCAAGGAGATGAGTCATGCGG + Intergenic
1132279555 15:100601779-100601801 ATGAATGGAGAGGGGTCGTGGGG - Intronic
1132440554 15:101860341-101860363 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1133039032 16:3050135-3050157 TGACATGGAGGTAGGTCCTGGGG + Exonic
1133351801 16:5106264-5106286 AGGCATGGTGGTGGGTGCCGAGG - Intergenic
1133432965 16:5754752-5754774 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1133509527 16:6444253-6444275 AGGCATTGTGCCGGGTCCTGGGG - Intronic
1133687385 16:8179125-8179147 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1134331194 16:13252495-13252517 CAGCATGAAGAAGGGTCCTGGGG - Intergenic
1134453746 16:14379167-14379189 AGGCATGGAGAGTGAGCCTGGGG - Intergenic
1134827905 16:17299237-17299259 AGGCATGGAGCTGGATGCTCTGG - Intronic
1134868466 16:17630142-17630164 AGGCATCGAGGTGGGAACTGTGG - Intergenic
1135550834 16:23397047-23397069 AGGCATGGTGGTGTGTCCTGTGG - Intronic
1135556067 16:23437543-23437565 AGGGCTGGAGATGAGTACTGAGG + Intronic
1135577896 16:23600057-23600079 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1135741168 16:24976387-24976409 AGGCATGGTGGTGTGTACTGTGG + Intronic
1135876079 16:26201236-26201258 AGGCACTGTGCTGGGTCCTGGGG - Intergenic
1135985369 16:27179955-27179977 AGGCATTGGGCTGGATCCTGGGG + Intergenic
1136399687 16:30010699-30010721 AGGCAGGCAGACAGGTCCTGGGG - Intronic
1136930330 16:34412421-34412443 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1136974244 16:34999385-34999407 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1137366629 16:47865040-47865062 AGGGCTGGAGGTGGGACCTGTGG + Intergenic
1137394124 16:48105044-48105066 AGGCATGGTGCTGGGCTCTGGGG - Intronic
1138110085 16:54316781-54316803 AGGCATGGAGAGAGGTGCTGGGG - Intergenic
1138111952 16:54330854-54330876 AGTCAGGGATATGGATCCTGGGG + Intergenic
1138295454 16:55881380-55881402 ATGCATGGAGGTTGGTCTTGAGG + Intronic
1138675028 16:58645036-58645058 GGGAATGGAGGTGGGTCCAGTGG - Intergenic
1139690200 16:68636365-68636387 AGGCAAATAGACGGGTCCTGAGG + Intronic
1140418850 16:74799757-74799779 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1141351464 16:83301864-83301886 AGGCAGGGAGAGGGGTGCTCTGG + Intronic
1141382574 16:83589283-83589305 AGGGAGGGAGAGGGGTCCGGGGG - Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142479772 17:211851-211873 AGGCCGGGAGAGGGGACCTGAGG + Intergenic
1142490599 17:276276-276298 AGGGATGAAAATGGTTCCTGGGG + Intronic
1143306597 17:5952417-5952439 AGGCATGGAGATGGGAGAAGTGG + Intronic
1143476410 17:7205954-7205976 AGGGATGGAGATGGAGCATGTGG - Intronic
1143882879 17:10043219-10043241 AGTCTTGGAGAGGGGCCCTGGGG - Intronic
1144512181 17:15886745-15886767 AGGCCTGGAGTGTGGTCCTGGGG + Intergenic
1144699641 17:17328547-17328569 AGGGCTGGAGATGGGTCTCGGGG + Intronic
1144745466 17:17611292-17611314 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1144825628 17:18104170-18104192 AGACATGGGGATGGCTCCTGTGG - Intronic
1144891291 17:18495841-18495863 AGGCATGGGGCTGTTTCCTGGGG - Intergenic
1145140933 17:20448476-20448498 AGGCATGGGGCTGTTTCCTGGGG + Intergenic
1146181388 17:30700405-30700427 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1146642460 17:34551493-34551515 AGGCATGGAGATAAGTGCTGCGG + Intergenic
1147048566 17:37773205-37773227 AGGCATGGTGCTTGGACCTGGGG + Intergenic
1147254619 17:39174498-39174520 AGGCATGGAGGTGGGGGGTGGGG + Exonic
1148855125 17:50574835-50574857 AGGCGTGGAGATGGGGACTGGGG + Intronic
1149202395 17:54202155-54202177 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1149620347 17:58040091-58040113 GGGCAGGGAGAAGGGACCTGGGG + Intergenic
1149693684 17:58599588-58599610 AGACATGGATCTGGGGCCTGAGG + Exonic
1149731591 17:58952018-58952040 AGTCATGTGGATGGGTCTTGGGG + Intronic
1150795783 17:68235594-68235616 AGGCACCGAGAGGGGCCCTGAGG - Intergenic
1151951401 17:77356279-77356301 AGGCAGGGAGATGGGGCTGGAGG - Intronic
1153143423 18:2001178-2001200 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1155835757 18:30582004-30582026 AGGCATTGAGCTGGGTGCTAAGG - Intergenic
1157419208 18:47531336-47531358 AGGCCTGGAGATGGGCTCTGAGG + Intergenic
1157486425 18:48090567-48090589 AGGACTGGGGATGAGTCCTGGGG + Intronic
1159781485 18:72665760-72665782 AGGCATGAAGAGGAGTCCTCTGG + Intergenic
1160421151 18:78746235-78746257 AGGGAGGGAAATGGGCCCTGGGG - Intergenic
1160675218 19:387251-387273 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1160843554 19:1156967-1156989 AGGCAGGGCTGTGGGTCCTGAGG - Intronic
1160928540 19:1558785-1558807 AGGCATCCAGGTGGGCCCTGAGG + Intronic
1161489866 19:4555943-4555965 AGGCCTGGAGGTTGGACCTGGGG + Intronic
1161980349 19:7627029-7627051 AGGCATAGCGATGGGTGCTGAGG - Intronic
1162097099 19:8316804-8316826 ATGCCTGGGGAGGGGTCCTGGGG + Intronic
1162565632 19:11444782-11444804 AGGGAGGGAGACCGGTCCTGGGG - Intronic
1162901124 19:13795928-13795950 AGGCAGGGTTAAGGGTCCTGGGG - Intronic
1163238928 19:16046981-16047003 AGGCAGGCAGATGGCGCCTGAGG + Intergenic
1163550776 19:17965526-17965548 AGGCCTGGAGGTGGGAACTGTGG + Intronic
1164370317 19:27637954-27637976 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1164579253 19:29424412-29424434 AGGCAAGGCAGTGGGTCCTGAGG + Intergenic
1164918830 19:32073274-32073296 ATGCATGGAGAGTAGTCCTGGGG - Intergenic
1165071301 19:33256319-33256341 AGGCATGGAGGGTGGTCCTGGGG + Intergenic
1165508045 19:36247329-36247351 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1165634850 19:37331986-37332008 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1165691446 19:37866758-37866780 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1165699503 19:37926597-37926619 AGGCTTGGGGAGGGGGCCTGAGG + Intronic
1165822496 19:38685469-38685491 AGGCCTGGAGAGGAGCCCTGTGG + Intronic
1166336552 19:42111743-42111765 AGGCATACAGATGGGACATGAGG - Intronic
1166653683 19:44594677-44594699 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1167371586 19:49085747-49085769 AGGGATGCAGAAGGGACCTGTGG - Intronic
1167646955 19:50711132-50711154 AGGCCTGGAGCTGGGTGCTGGGG - Intronic
1167706170 19:51082501-51082523 AGAGATGGGGATGGGTCCTTGGG - Intronic
1167755721 19:51412234-51412256 AGGCATGCAGAAGGGGCCAGTGG + Intronic
1168063965 19:53909209-53909231 AGGGAGGGAGATGGGCCTTGAGG - Intergenic
1168124936 19:54277890-54277912 AGGTGTGGAGATGGGACCGGTGG + Exonic
1168641562 19:58034592-58034614 AGGGAGGGAGATGGGTCCGGGGG - Intronic
926006242 2:9375367-9375389 CGGCACGGAGAGGGGTACTGGGG + Intronic
926541840 2:14190351-14190373 AGGCATCGAGCTAGGTACTGTGG - Intergenic
927227953 2:20789094-20789116 GGGCATGGAGGTGGGTGCAGAGG - Intronic
927311300 2:21634719-21634741 ATGCTGGGAGGTGGGTCCTGTGG + Intergenic
927700264 2:25263770-25263792 GGGCATGGAGTGGGGTCCTAAGG - Intronic
927846286 2:26474272-26474294 GGGCCTGGAGCTGGGGCCTGGGG - Intronic
927992878 2:27460560-27460582 AGGGCTGGAGGTGGGACCTGCGG + Intronic
928102846 2:28449512-28449534 AGGCATGGAGGTGGGGGCTCGGG - Intergenic
928355827 2:30613836-30613858 AGGGCTGGAGGTGGGACCTGTGG - Intronic
928431009 2:31218345-31218367 AGGCATGGTTCTGGGTTCTGGGG - Intronic
928990277 2:37225899-37225921 AGGGCTGGAGGTGGGACCTGTGG + Intronic
929270159 2:39963232-39963254 GGTGTTGGAGATGGGTCCTGAGG + Intergenic
929270239 2:39963983-39964005 GGTGTTGGAGATGGGTCCTGAGG - Intergenic
930119447 2:47748186-47748208 ATGCAGGGAGCTGTGTCCTGAGG - Intronic
930635525 2:53801339-53801361 AGACATGGAGATGGGACTGGGGG - Intronic
931423611 2:62150937-62150959 AGGCATGGTGCTGGGTGCTTTGG - Intergenic
931640088 2:64374389-64374411 AGGTATGCAGGAGGGTCCTGGGG - Intergenic
931799747 2:65747307-65747329 AGGCCTGAAAGTGGGTCCTGTGG + Intergenic
932001368 2:67888303-67888325 AGGCATTGAGCTGGATGCTGTGG - Intergenic
932577584 2:72971311-72971333 AAGCAAGAAGCTGGGTCCTGAGG + Intronic
932749702 2:74363515-74363537 AGGACTGGAGATGGGTGATGGGG - Intronic
932798475 2:74718272-74718294 AGGCATTGAGCTGAATCCTGAGG + Intergenic
936173878 2:110201333-110201355 AGGCATAGAGATTGGTCCTTTGG - Intronic
936373897 2:111924828-111924850 AGGGATGGAGAAGGTGCCTGGGG - Intronic
936531305 2:113278523-113278545 AGGCCTGGGGAGGGGGCCTGAGG - Exonic
937111287 2:119368421-119368443 GGGTATGGTGATGGTTCCTGAGG + Intronic
938046983 2:128130572-128130594 AAGCATGATGATGGGTCCTATGG - Intronic
938322248 2:130373018-130373040 GGGCATGGAGCTTAGTCCTGTGG + Intronic
938491428 2:131763224-131763246 AGGCATGCACATTGGGCCTGGGG + Intronic
938496135 2:131799099-131799121 AGGCATGCACATTGGGCCTGGGG - Intronic
942073338 2:172335083-172335105 TGGCATGCAAATGGGGCCTGGGG - Intergenic
944673233 2:202013872-202013894 AGGAATGGAGATGTTTCCTATGG + Intergenic
945175252 2:207037407-207037429 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
945545886 2:211151194-211151216 AGGAATGGAGAAAGATCCTGAGG + Intergenic
946172892 2:217905849-217905871 AGGCTGGGAGATGGGTCCACGGG - Intronic
946195514 2:218030507-218030529 AGGCATGGAGCTTGGGGCTGGGG - Intergenic
947531524 2:230911755-230911777 AGGAATGGAGCGGGGCCCTGAGG + Intronic
947619122 2:231577357-231577379 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
947837522 2:233186359-233186381 AGGCATAGAGAGGGGTCCATTGG + Intronic
947985842 2:234446817-234446839 AGGCCTGGACTTGGATCCTGGGG - Intergenic
1168962400 20:1878192-1878214 AGACAGGGAGATGGGAACTGTGG + Intergenic
1169770114 20:9190709-9190731 AGGCAAGGAGCAGGTTCCTGGGG + Intronic
1170651971 20:18251223-18251245 AGGCTGGGCGATGGGTACTGTGG + Intergenic
1170800934 20:19589818-19589840 AGGCAAGGAAATGGATACTGGGG + Intronic
1171326292 20:24296501-24296523 AGGCATGGAGGAGGATGCTGGGG - Intergenic
1172479463 20:35262488-35262510 AGGGCTGGAGGTGGGACCTGCGG - Intronic
1172510390 20:35496911-35496933 AGAGATGGACATGGCTCCTGTGG + Intronic
1173006439 20:39143018-39143040 AGGCACTGAGATGGGTCCAAAGG + Intergenic
1173181350 20:40808779-40808801 AGGCATTGAGATTGTTCCCGGGG + Intergenic
1173319105 20:41971477-41971499 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1173361189 20:42346160-42346182 AGTCATGGAGACTGGTCCTCTGG - Intronic
1173809866 20:45949149-45949171 AGGTATGGAGCTGGATCCTGAGG - Exonic
1174680234 20:52399467-52399489 AGCCATGGAGATAGATCCAGAGG - Intergenic
1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG + Intergenic
1175363958 20:58438097-58438119 AGGGATGGAGATGGGTCTTGGGG + Intronic
1175679609 20:60976473-60976495 AGGGATGGCAATGGGTTCTGGGG + Intergenic
1175991036 20:62789222-62789244 AGGCCAGGTGATGGGCCCTGGGG + Intergenic
1176233546 20:64043464-64043486 ACGCCTGGAGCTGGCTCCTGGGG + Intronic
1176267328 20:64217020-64217042 AGCCAGTGAGATGGGACCTGGGG - Intronic
1176424396 21:6539179-6539201 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1176616584 21:9031557-9031579 AGGCATGCACATTGGGCCTGGGG - Intergenic
1176708547 21:10132075-10132097 AGGCATGCACATTGGGCCTGGGG + Intergenic
1177095201 21:16823733-16823755 AGGTATGTAACTGGGTCCTGAGG + Intergenic
1177249075 21:18569041-18569063 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1179168615 21:38955337-38955359 AGGCCTGGAGATGGATAGTGGGG + Intergenic
1179699889 21:43147494-43147516 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1179828144 21:43979787-43979809 AGGCAGGGAGCTGGGTGCTCAGG + Intronic
1179912017 21:44455578-44455600 AGGCGTGGAGCTGGGTCTGGCGG + Exonic
1180292640 22:10859340-10859362 AGGCATGCACATTGGGCCTGGGG + Intergenic
1180333059 22:11550244-11550266 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1180456164 22:15513742-15513764 AGGCATGCACATTGGGCCTGGGG + Intergenic
1180495445 22:15888762-15888784 AGGCATGCACATTGGGCCTGGGG + Intergenic
1180837771 22:18939255-18939277 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1180838680 22:18947462-18947484 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1180979215 22:19870930-19870952 GGGCTTGGAGGTGGGCCCTGTGG + Intergenic
1181411287 22:22721574-22721596 ATGCATGGAGCTGGGGCTTGAGG - Intergenic
1181465504 22:23108566-23108588 AAGCAGGTAGATGGATCCTGAGG + Intronic
1181540361 22:23569767-23569789 AGGCATGGAGATCTGTCAGGCGG - Intergenic
1181642571 22:24211252-24211274 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1181694268 22:24585140-24585162 AGGCCTGGGGCTGGGTCCTGAGG + Intronic
1181812730 22:25413823-25413845 AGGCAGGGAGCAGTGTCCTGAGG + Intergenic
1183080532 22:35452985-35453007 AGGCATGGAGAGGGCTGCTCAGG + Intergenic
1183111782 22:35654951-35654973 AGGCCTGGAGATGGTACCAGAGG + Intronic
1183228741 22:36567760-36567782 GGACACGGAGCTGGGTCCTGAGG - Intronic
1184003679 22:41693640-41693662 GGGCCTGGACATGGGTGCTGTGG - Exonic
1184028989 22:41879933-41879955 AGGCATGAAGCCGGGTGCTGTGG + Intronic
1184718209 22:46294030-46294052 AGGCCTGGGGCTGGGTCCTGGGG + Intergenic
1203287862 22_KI270734v1_random:164554-164576 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
950016675 3:9759432-9759454 AGGGATGGGGAGGAGTCCTGGGG + Intronic
950111460 3:10421346-10421368 AGGGAAGGAGAAGGGCCCTGTGG - Intronic
951049999 3:18083636-18083658 AGGCAGGTAGTTGGGTCATGTGG + Intronic
952333124 3:32382940-32382962 AGGCATTGTGATTGGTGCTGAGG + Intergenic
953807813 3:46086477-46086499 AGGCATGGAGAAGGGCTCTCAGG - Intergenic
953916704 3:46925094-46925116 GGGCAGGGTGATGGGTCCTGTGG - Intronic
953960124 3:47260115-47260137 AGGGCTGGAGGTGGGACCTGCGG + Intronic
954440708 3:50520463-50520485 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
954629644 3:52040895-52040917 GGGCATGGAGAAGGGGCCTCAGG - Intergenic
954896257 3:53977878-53977900 AGGGCTGGAGGTGGGACCTGTGG - Intergenic
955136714 3:56226316-56226338 AGGCATGGTGCTAGGTGCTGGGG - Intronic
956007623 3:64797671-64797693 TGGGATGGAGCAGGGTCCTGGGG + Intergenic
956210859 3:66799784-66799806 AGGCATGAAGAAGGGTCCTATGG - Intergenic
958499546 3:94887862-94887884 AGGCATGGAAATGGATATTGAGG + Intergenic
959871660 3:111335731-111335753 AGGGATGGAGGTTGGTACTGTGG - Intronic
961123610 3:124396062-124396084 AGGCATGGGGTTGGTTGCTGAGG - Intronic
961296780 3:125891032-125891054 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
961614306 3:128166758-128166780 AGGCGTGGTGATGGATCCAGAGG - Intronic
962751951 3:138440132-138440154 AGGCAGCGAGTGGGGTCCTGTGG - Intronic
963822939 3:149919400-149919422 GGGCATGGAGAAGGGTAGTGAGG - Intronic
965656311 3:170989084-170989106 AGGTATGGAGATGAGGTCTGTGG + Intergenic
966002365 3:174965884-174965906 AGGCAAGGAGAGGGGTCCTGGGG + Intronic
966073317 3:175905914-175905936 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
966639937 3:182178369-182178391 AAGTTTGGAGATGTGTCCTGAGG + Intergenic
967025825 3:185562912-185562934 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
967026736 3:185571124-185571146 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
967264054 3:187674541-187674563 GGGAATTGAGATGGGCCCTGAGG - Intergenic
968095573 3:195927889-195927911 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
968757855 4:2426119-2426141 AGGCATGGCTGTGGGGCCTGAGG + Intronic
968815551 4:2819881-2819903 GGGCATGATGTTGGGTCCTGTGG + Intronic
969255748 4:6000597-6000619 AGGCAAGGAAATGAGCCCTGTGG - Intergenic
969287064 4:6209451-6209473 GGGCAGGGAGATGGGACCAGGGG + Intergenic
969815271 4:9682332-9682354 AGGCATGGTGGTGGGTGCCGAGG + Intergenic
971336731 4:25730072-25730094 AGGCATGGTGGCGGGTGCTGAGG - Intergenic
972598863 4:40554084-40554106 AGGCACCGTGCTGGGTCCTGGGG - Intronic
974517999 4:62941459-62941481 AGGGATGGAGGTGGGACCTGCGG + Intergenic
974628318 4:64452456-64452478 AGTGTTGGAGGTGGGTCCTGTGG - Intergenic
975246797 4:72129588-72129610 AGGGCTGGAGGTGGGACCTGCGG - Intronic
977389614 4:96391077-96391099 AGTGTTGGAGATGGGGCCTGTGG + Intergenic
977507538 4:97921275-97921297 AGGAATTGAGCTGGATCCTGGGG - Intronic
978481972 4:109203077-109203099 AGTCATGAAGGTGGGACCTGGGG - Intronic
979322695 4:119342898-119342920 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
979888911 4:126065192-126065214 GGTCCTGGGGATGGGTCCTGAGG + Intergenic
981405458 4:144362290-144362312 AGGCATGGTGATGCTGCCTGTGG + Intergenic
982210210 4:153028617-153028639 ATGCAGGGAGCTGTGTCCTGAGG + Intergenic
982512812 4:156305126-156305148 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
982876633 4:160659367-160659389 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
984951876 4:185014135-185014157 CGGCAGTGAGAGGGGTCCTGGGG - Intergenic
985495086 5:199700-199722 AGGCAGGGAGTGGGGTGCTGGGG - Exonic
985738042 5:1596341-1596363 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
985881565 5:2642291-2642313 AGGCAGGGACTGGGGTCCTGAGG - Intergenic
986524491 5:8658717-8658739 TTGGATGGAGATGGGGCCTGTGG + Intergenic
986549662 5:8938322-8938344 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
986829058 5:11555564-11555586 AAGCATGGAGATGAATCTTGAGG + Intronic
986924770 5:12733019-12733041 AGTGTTAGAGATGGGTCCTGAGG - Intergenic
987031621 5:13981350-13981372 AGGCACGGTGCTGGGTGCTGGGG - Intergenic
987490894 5:18579036-18579058 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
988262979 5:28912686-28912708 ATGCAGGGAGCAGGGTCCTGAGG - Intergenic
988379950 5:30487017-30487039 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
988850640 5:35176967-35176989 AGGGCTGGAGGTGGGACCTGCGG + Intronic
989467029 5:41768927-41768949 TGGCATGGAAATGGGAACTGGGG - Intronic
989737883 5:44730851-44730873 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
989973801 5:50556800-50556822 AGGCAAGGAGAGGTGTCCTAAGG - Intergenic
990414328 5:55571653-55571675 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
990613358 5:57482236-57482258 AGGCATCGTGATGGATTCTGGGG - Exonic
990911637 5:60858115-60858137 AAGCATGGATATGCCTCCTGTGG - Intergenic
991532725 5:67633792-67633814 GGGCAAGGAGTTGAGTCCTGAGG + Intergenic
991544629 5:67767773-67767795 AGACATGGAGATGAGTCATGAGG + Intergenic
992320169 5:75606197-75606219 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
994197535 5:96936304-96936326 AGGCAGGGAGAGGGGATCTGGGG + Intronic
994227945 5:97275764-97275786 AAGCATGGAGATGGTAACTGAGG - Intergenic
995223056 5:109672696-109672718 AGGCATGGTGCTAGGTGCTGGGG - Intergenic
996163375 5:120195048-120195070 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
997783453 5:136683596-136683618 AGGCATGCAGAAGGGTCAAGTGG + Intergenic
998077464 5:139248152-139248174 AGGCATGGGGATGAATACTGTGG + Intronic
998397941 5:141831521-141831543 TGGGATGGAGATGGGGGCTGAGG - Intergenic
998820308 5:146052085-146052107 AGTCGTGGGGATGGGCCCTGGGG - Intronic
999091255 5:148938148-148938170 AGGCCTGGAGAGGGGTCTGGGGG - Intronic
999836947 5:155383936-155383958 TGGGATGCAGATGGGTTCTGGGG - Intergenic
999951670 5:156658070-156658092 AGGGCTGGAGGTGGGACCTGCGG - Intronic
999952573 5:156666282-156666304 AGGGCTGGAGGTGGGACCTGCGG - Intronic
1000040073 5:157478948-157478970 AGGCATGGGGTTGGGTTTTGAGG + Exonic
1000125769 5:158242381-158242403 TGGCATCGTGATGGGCCCTGGGG + Intergenic
1001224550 5:169932512-169932534 AGGCATGCAGATTGTTCCTGAGG - Intronic
1001232070 5:169997239-169997261 AGGGCTGGAGGTGGGACCTGCGG - Intronic
1001250093 5:170140455-170140477 GGGCATGGACATATGTCCTGGGG + Intergenic
1002092570 5:176813727-176813749 AGGCAGGAAGAAGGGTCGTGAGG - Intronic
1002297400 5:178239200-178239222 AGTGATGGGGATGGGGCCTGGGG + Intronic
1002482763 5:179514327-179514349 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1002880279 6:1244673-1244695 TGGGATGGAGATGGGGGCTGTGG + Intergenic
1003852039 6:10234602-10234624 AGGCATGGAGAAGAGTCCATAGG + Intergenic
1003896177 6:10609762-10609784 AAGCATGAAGCTGGGTCCAGGGG + Intronic
1006399742 6:33810324-33810346 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1006433081 6:34010103-34010125 AGGCAAGGGGAGGGGGCCTGTGG - Intergenic
1007262699 6:40575021-40575043 AGCCATGGCAATGGGTCCTTAGG + Intronic
1007341695 6:41194682-41194704 AGGCAAGGTGATGAGTCCTGGGG + Exonic
1008583024 6:52923254-52923276 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1010591423 6:77717309-77717331 AGGGCTGGAGGTGGGACCTGCGG - Intronic
1010592360 6:77725771-77725793 AGGGCTGGAGGTGGGACCTGCGG - Intronic
1010686452 6:78859369-78859391 AGGGCTGGAGGTGGGACCTGTGG + Intergenic
1010711456 6:79180108-79180130 GGGCCTGGAGATAGGACCTGAGG + Intergenic
1011536591 6:88382169-88382191 AGGGCTGGAGGTGGGACCTGTGG + Intergenic
1011739749 6:90347977-90347999 GGGGATGGACATGGGTCTTGAGG + Intergenic
1011967210 6:93173944-93173966 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1013193716 6:107826637-107826659 AGGCAAGGAGGTTGGGCCTGAGG - Intergenic
1013608967 6:111776226-111776248 AGGCATGGAAATGGCCCCTGAGG + Intronic
1015574745 6:134659474-134659496 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1015878154 6:137844961-137844983 AGGCCTGGAGGTGGGACATGCGG + Intergenic
1016439497 6:144068483-144068505 AGGCAGGGAGATGGCTGCTGGGG - Intergenic
1016632896 6:146252494-146252516 AGGCATGGTGGTGGGTGCTGAGG + Intronic
1016896900 6:149062453-149062475 AGGCATGGAGCTGGACACTGGGG + Intronic
1017039113 6:150293685-150293707 AGGCATGGAAATGAGGCCTAAGG - Intergenic
1017626705 6:156356643-156356665 AAGCATGGAAGTGAGTCCTGAGG - Intergenic
1017772171 6:157651932-157651954 AGGGATGGGGCTGGGACCTGGGG - Intronic
1017938354 6:159027308-159027330 AGGCATGCAGAGTGGTACTGTGG + Intergenic
1018068656 6:160141953-160141975 AGGCCTGGAGATATTTCCTGCGG - Intronic
1019071206 6:169346649-169346671 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1019496212 7:1341704-1341726 AAGCAGGGAGAGGGCTCCTGGGG + Intergenic
1019656177 7:2197352-2197374 AGGCCTGGTGCTGGGTGCTGGGG - Intronic
1019734502 7:2644139-2644161 AGACGTGGGCATGGGTCCTGTGG + Intronic
1019976096 7:4582790-4582812 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1019977030 7:4591294-4591316 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1019977966 7:4599797-4599819 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1020329343 7:7002138-7002160 AGGGCTGGAGATGGGACCTGTGG - Intergenic
1021067820 7:16198303-16198325 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1021671628 7:23040437-23040459 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1021958947 7:25853108-25853130 ACAAATGGAGATGGGACCTGTGG - Intergenic
1022412725 7:30151742-30151764 CGGCCTGGAGTTGGGTCCTGTGG + Intronic
1022496303 7:30855112-30855134 AGGCCTGGAGCAGGGGCCTGGGG + Intronic
1022943775 7:35262220-35262242 AGGCTGGGGGCTGGGTCCTGAGG + Intergenic
1023046394 7:36214126-36214148 AGGGATGGAGGCAGGTCCTGGGG + Intronic
1023157350 7:37264392-37264414 AGGCAAGTAGATGTGACCTGTGG + Intronic
1023940044 7:44763365-44763387 GGGCAGGGAGCTGGATCCTGCGG - Exonic
1024912971 7:54467034-54467056 AGGAATGGAGATGGCCACTGGGG - Intergenic
1026887848 7:73964879-73964901 AGGCATGGGCCTGGGTCCTAAGG + Intergenic
1027056458 7:75053083-75053105 ATGCATGGAGCTGGGGTCTGGGG + Intronic
1029966757 7:104748502-104748524 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1030345353 7:108427135-108427157 AGGAATGGAGATGGGCCTTCAGG - Intronic
1030364512 7:108630181-108630203 TGGCATGGAGAGGGCTGCTGTGG + Intergenic
1030636371 7:111953827-111953849 AGGCCTGGAGATGGCACCAGAGG + Intronic
1031607023 7:123781218-123781240 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1031724558 7:125221534-125221556 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1031795463 7:126168741-126168763 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1032560342 7:132884278-132884300 AGGCATGGAGTTGGGTACAGAGG - Intronic
1032663480 7:134011805-134011827 AGGCATGGGGAGGGGACCAGAGG + Intronic
1034430877 7:151040651-151040673 AGGCGTGGGGATGGGTCCCTGGG + Intronic
1034445177 7:151110442-151110464 GGGGATGGAGGCGGGTCCTGGGG + Intronic
1034807878 7:154104566-154104588 TGGCATGGACATGGGACATGTGG + Intronic
1035349698 7:158237372-158237394 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1035409857 7:158630886-158630908 GGGTATTGGGATGGGTCCTGTGG - Intergenic
1036291645 8:7498239-7498261 AGGGCTGGAGGTGGGACCTGCGG - Intronic
1036292576 8:7506742-7506764 AGGGCTGGAGGTGGGACCTGCGG - Intronic
1036378616 8:8221466-8221488 AGGCATGGTGGTGGGTGCCGAGG + Intergenic
1036587965 8:10142390-10142412 AGTGATGGAGATGGCACCTGAGG + Intronic
1036637368 8:10560657-10560679 AGGAATGGGGATGGAGCCTGAGG - Intergenic
1036872322 8:12443432-12443454 AGGCATGGTGGTGGGTGCCGAGG - Intergenic
1037429485 8:18794530-18794552 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1038422539 8:27442684-27442706 AGGCTTGGATATGGGCCCTGAGG - Intronic
1038571736 8:28668475-28668497 AGGCATGGTGGTGGGCACTGTGG - Intronic
1039392608 8:37193732-37193754 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1040413266 8:47176397-47176419 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1041060708 8:54032045-54032067 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1041713765 8:60915184-60915206 AGGCAGGGACATGGGTCTAGAGG + Intergenic
1043729258 8:83653566-83653588 GGGCATGGTGATGGCACCTGTGG + Intergenic
1044310212 8:90684613-90684635 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1044310344 8:90685460-90685482 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1046703994 8:117430175-117430197 AGGAATTGAAGTGGGTCCTGGGG + Intergenic
1047686198 8:127306886-127306908 AGGCATTGTCCTGGGTCCTGAGG + Intergenic
1048853951 8:138670416-138670438 AGGCCGGGAGCTGGGGCCTGGGG + Intronic
1048947175 8:139460270-139460292 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1049222000 8:141432631-141432653 GGGCATGGAGGTGGGGCCTTGGG + Intergenic
1049222101 8:141432903-141432925 GGGCATGGAGGCGGGGCCTGGGG + Intergenic
1049420360 8:142513720-142513742 AGGCTTGAAGTGGGGTCCTGAGG + Intronic
1049663670 8:143832570-143832592 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1049667077 8:143850067-143850089 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1049874544 8:145007817-145007839 AGGAAAGGAGATGAGTCTTGGGG + Intergenic
1049993982 9:1017449-1017471 ATGCATGATGAGGGGTCCTGGGG - Intergenic
1050078865 9:1893826-1893848 AGGTTTGCAGATGAGTCCTGAGG + Intergenic
1051471322 9:17445942-17445964 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1052676543 9:31633243-31633265 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1053015068 9:34657214-34657236 AGGCAGGGAGGTAGGTTCTGAGG + Intronic
1053645514 9:40117588-40117610 AGGCATGCACATTGGGCCTGGGG + Intergenic
1053760200 9:41345939-41345961 AGGCATGCACATTGGGCCTGGGG - Intergenic
1054322202 9:63681973-63681995 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1054326532 9:63715489-63715511 AGGCATGCACATTGGGCCTGGGG + Intergenic
1054539059 9:66258384-66258406 AGGCATGCACATTGGGCCTGGGG - Intergenic
1054843075 9:69763501-69763523 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1055787737 9:79888303-79888325 ATGCATGGAAATGGATCCTAAGG - Intergenic
1056312237 9:85352401-85352423 AGTGTTGGAGATGGGGCCTGAGG - Intergenic
1057271090 9:93651879-93651901 ATGGCTGGAGATGGGTCATGAGG + Intronic
1057316287 9:93970843-93970865 AGGCATGGGGATGGGTATTAAGG + Intergenic
1057763100 9:97892070-97892092 AAGGATGGAGATGGGTGCTCTGG - Intergenic
1057804552 9:98210982-98211004 GGGAAAGGAGATGGGCCCTGAGG + Intronic
1057875340 9:98749310-98749332 AGGGAGGGAGCTGGGGCCTGAGG - Intronic
1057964928 9:99493417-99493439 AGTTATGGAGATGGGCTCTGTGG - Intergenic
1058806290 9:108595186-108595208 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1059592489 9:115677241-115677263 GATCATGGGGATGGGTCCTGAGG - Intergenic
1059666187 9:116448399-116448421 AAGCATAGAGATGGGCACTGAGG - Intronic
1060167400 9:121429687-121429709 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1060524187 9:124311315-124311337 TGGCATGGAGCTGGGTGATGTGG + Intronic
1060977239 9:127771725-127771747 GGGCCTGATGATGGGTCCTGGGG - Intronic
1061494153 9:130962160-130962182 AGGCATGGGGCTGAGTCTTGGGG + Intergenic
1061554289 9:131357292-131357314 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1061955315 9:133958354-133958376 AGGGCTGGAGGTGGGACCTGCGG + Intronic
1061963926 9:134002866-134002888 AGGCCAGGAGATGGTCCCTGAGG - Intergenic
1061994121 9:134175426-134175448 AGGGAGGAAGCTGGGTCCTGTGG - Intergenic
1062425341 9:136503664-136503686 GGGCCTGGGGATGGCTCCTGGGG - Intronic
1062619975 9:137416333-137416355 TGACATGGAGATAGGTCGTGAGG - Intronic
1202793308 9_KI270719v1_random:101044-101066 AGGCATGCACATTGGGCCTGGGG + Intergenic
1187501220 X:19840626-19840648 AGGCAAGGAAATGGGTTTTGGGG - Intronic
1188194717 X:27218968-27218990 AGTCTTGGAGAGGGGTCCTCAGG + Intergenic
1188550528 X:31359697-31359719 AGGCACTGACCTGGGTCCTGGGG - Intronic
1189298206 X:39933963-39933985 AGGCTCTGAGCTGGGTCCTGGGG - Intergenic
1189387691 X:40550807-40550829 AGGCATGGAGCTGGGCGCAGTGG + Intergenic
1190100329 X:47518049-47518071 AGGCAGGCAGGTGGGTTCTGGGG - Intergenic
1191958121 X:66668487-66668509 AGGCATGAAGATGGTCACTGGGG + Intergenic
1193082862 X:77422911-77422933 AGGCTTGGAGATCAGACCTGGGG - Intergenic
1193296058 X:79831727-79831749 AGGCTTGTTGATGGGTCCTCAGG - Intergenic
1194200801 X:90951197-90951219 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1196457952 X:115903219-115903241 AGGAATGAAGATGGGTCACGTGG - Intergenic
1197333542 X:125182723-125182745 AGGCATGGTGCTAGGTGCTGGGG - Intergenic
1197372337 X:125640310-125640332 GGTGATGGAGATGGGTCCTGAGG + Intergenic
1197383889 X:125780092-125780114 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1198111810 X:133508877-133508899 AGGAAAGGAGATGGCTGCTGTGG - Intergenic
1198640877 X:138755217-138755239 AGGCATGGAGTTAGGTGCTAGGG - Intronic
1198675943 X:139130552-139130574 AGGCATTGTGATAGGTACTGGGG - Intronic
1199256179 X:145721205-145721227 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1199351810 X:146810481-146810503 AGGCAGGGAGGTGGCTTCTGTGG + Intergenic
1199352097 X:146814012-146814034 AGGCAGGGAGGTGGCTTCTGTGG - Intergenic
1199454553 X:148013824-148013846 AGGAATGGAGAAGGGTCAAGGGG - Intronic
1199701544 X:150380987-150381009 AGGGAAGGGGATGGGTGCTGTGG - Intronic
1200212392 X:154352516-154352538 AAGCCTGGGGAGGGGTCCTGGGG - Intronic
1200731684 Y:6749469-6749491 AGGGCTGGAGGTGGGACCTGCGG + Intergenic
1201105219 Y:10758278-10758300 TGGAATGGAGATGGGTCGTGTGG - Intergenic
1201149964 Y:11090280-11090302 AGGCATGCACATTGGGCCTGGGG - Intergenic
1202253116 Y:22893403-22893425 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1202406106 Y:24527152-24527174 AGGGCTGGAGGTGGGACCTGCGG - Intergenic
1202464676 Y:25142929-25142951 AGGGCTGGAGGTGGGACCTGCGG + Intergenic