ID: 1077237575

View in Genome Browser
Species Human (GRCh38)
Location 11:1489075-1489097
Sequence GGTCGCAACCAAGGCGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 42}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077237570_1077237575 -7 Left 1077237570 11:1489059-1489081 CCACGCAGGGGGGAACGGTCGCA 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1077237575 11:1489075-1489097 GGTCGCAACCAAGGCGGGACGGG 0: 1
1: 0
2: 0
3: 8
4: 42
1077237559_1077237575 28 Left 1077237559 11:1489024-1489046 CCAGGAACAGAGAGCACAGGAGC 0: 1
1: 0
2: 3
3: 38
4: 326
Right 1077237575 11:1489075-1489097 GGTCGCAACCAAGGCGGGACGGG 0: 1
1: 0
2: 0
3: 8
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077237575 Original CRISPR GGTCGCAACCAAGGCGGGAC GGG Intronic
900427358 1:2586741-2586763 GGCAGCAAGAAAGGCGGGACCGG + Intronic
904492603 1:30870208-30870230 GGTGGCAACCAGGGCTGGGCAGG - Intronic
916649600 1:166822530-166822552 GCTCTGAACCAAGCCGGGACGGG - Intergenic
1064416676 10:15155938-15155960 AGTCGCATCCAGGGCGGGACAGG + Intronic
1077237575 11:1489075-1489097 GGTCGCAACCAAGGCGGGACGGG + Intronic
1083334193 11:61913329-61913351 GGTGGGAACCAAGGTGGGCCTGG + Intronic
1084013492 11:66365528-66365550 GGTCTCATCCAAGTCAGGACAGG - Intronic
1090602335 11:128386205-128386227 GGTCACATCCAAGGTGGCACAGG + Intergenic
1096706314 12:53424534-53424556 GGTGGCAACCAAGGGGGAAGGGG + Intronic
1101079861 12:101171679-101171701 GGTAGCGACCAAGTCTGGACGGG + Intronic
1101482118 12:105108035-105108057 GGTCCCAGCCACGGCGGGTCAGG + Intronic
1103841626 12:123869876-123869898 GGCAGCAACCCAGGCGGGGCAGG - Intronic
1109377019 13:61509293-61509315 TGTCAATACCAAGGCGGGACTGG + Intergenic
1128885420 15:71282517-71282539 TGTCGGAACCAAGGCAGCACTGG - Intronic
1132497535 16:270907-270929 GGTGGAAACCGAGGCGGGAGGGG + Intronic
1136136286 16:28258728-28258750 AGTCGCAGCCGAGCCGGGACCGG + Intergenic
1136585348 16:31180773-31180795 CGTGGCAACCCAGGCGGGAACGG - Intronic
1137020839 16:35425566-35425588 GGCGGCGACCAAGGCGGGACTGG + Intergenic
1160580286 18:79879868-79879890 GGTCCCACCAAAGGCAGGACAGG + Intronic
1160691187 19:461225-461247 ACCCGCAGCCAAGGCGGGACGGG + Intergenic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1166835945 19:45668157-45668179 GGGCGGGGCCAAGGCGGGACAGG - Intergenic
1168154109 19:54463687-54463709 GCTCTCCACCAAGGAGGGACTGG - Exonic
930353312 2:50285363-50285385 GGTAGAAACCAAGCCTGGACAGG + Intronic
936572674 2:113629356-113629378 GGTAGAAACCAAGGTGGGCCTGG - Intronic
938280596 2:130061129-130061151 GGTGGCAGCCAAGGCAGGACAGG + Intergenic
938332083 2:130455035-130455057 GGTGGCAGCCAAGGCAGGACAGG + Intergenic
938357727 2:130665633-130665655 GGTGGCAGCCAAGGCAGGACAGG - Intergenic
938358234 2:130668652-130668674 GGTGGCAGCCAAGGCAGGACAGG - Intergenic
1171997044 20:31739488-31739510 GGTCGCCGCCTAGGCGGGGCAGG + Exonic
1172890166 20:38258720-38258742 GCTCGCAAGCAAGGCTGGAGTGG + Intronic
1185349389 22:50326734-50326756 GGCCCCAAGCGAGGCGGGACTGG + Intronic
1185427516 22:50781523-50781545 GGTAGAAACCAAGGTGGGCCTGG + Intronic
952627676 3:35426557-35426579 GGTCGTTACCAGGGCGGCACTGG - Intergenic
954649844 3:52154361-52154383 GGGCGCAGCCATGGCGGGGCTGG + Exonic
963163414 3:142175717-142175739 GGTTGCAATCATGGCAGGACAGG + Intronic
967131358 3:186473595-186473617 GGTCTCCACCAAGGAGGCACAGG + Intergenic
989150038 5:38290279-38290301 AGTCTCAACCAAGGAGGGATAGG - Intronic
995444212 5:112224585-112224607 GGTCACAACCAAGGCAGACCAGG + Intronic
1006131492 6:31871752-31871774 GGTCCAAACCAAGGCACGACAGG - Intronic
1012865788 6:104616398-104616420 GGTTGGGACCAAGGTGGGACTGG + Intergenic
1015935660 6:138404289-138404311 CGCCGCCACCAAGGCGGGGCCGG - Exonic
1016384536 6:143517401-143517423 GGGAGGAACCAAGGAGGGACTGG + Intergenic
1018575154 6:165252051-165252073 GGTCACAACCAGGGGAGGACAGG + Intergenic
1022298410 7:29079753-29079775 GGTGGCAACCAAGGTGGGGTGGG - Intronic
1024490920 7:49985103-49985125 GGTGGGAACCAACGCTGGACAGG - Intronic
1027127771 7:75569044-75569066 GCTACCAACCAAGCCGGGACTGG - Intronic
1061670379 9:132185106-132185128 GGCCCCAACCAAGGCGGGGCAGG + Intronic
1061807928 9:133146921-133146943 GGTCTCATCCATGGCTGGACTGG - Intronic
1187648291 X:21374025-21374047 GGTGGCGGCCACGGCGGGACGGG - Intergenic
1189433139 X:40967474-40967496 GGTCTCAACCAAGGCAGGAAGGG - Intergenic