ID: 1077239223

View in Genome Browser
Species Human (GRCh38)
Location 11:1501964-1501986
Sequence CTGTAGGCACAGAGAGACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077239223_1077239230 13 Left 1077239223 11:1501964-1501986 CCACCGTCTCTCTGTGCCTACAG No data
Right 1077239230 11:1502000-1502022 CAGCCATCTGTTCATACTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077239223 Original CRISPR CTGTAGGCACAGAGAGACGG TGG (reversed) Intergenic
No off target data available for this crispr