ID: 1077239334

View in Genome Browser
Species Human (GRCh38)
Location 11:1502463-1502485
Sequence GTGCCTGGTGGGAGTCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077239334_1077239343 -5 Left 1077239334 11:1502463-1502485 CCCCCATGACTCCCACCAGGCAC No data
Right 1077239343 11:1502481-1502503 GGCACGACCTACTGGCTCCTGGG No data
1077239334_1077239342 -6 Left 1077239334 11:1502463-1502485 CCCCCATGACTCCCACCAGGCAC No data
Right 1077239342 11:1502480-1502502 AGGCACGACCTACTGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077239334 Original CRISPR GTGCCTGGTGGGAGTCATGG GGG (reversed) Intergenic
No off target data available for this crispr