ID: 1077243094

View in Genome Browser
Species Human (GRCh38)
Location 11:1521671-1521693
Sequence CTTTGGAAGGTGAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148242
Summary {0: 5, 1: 125, 2: 2466, 3: 32371, 4: 113275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077243084_1077243094 23 Left 1077243084 11:1521625-1521647 CCACTAAAGGAGGGTGTGCACGG No data
Right 1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG 0: 5
1: 125
2: 2466
3: 32371
4: 113275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077243094 Original CRISPR CTTTGGAAGGTGAAGGTGGG TGG Intergenic
Too many off-targets to display for this crispr