ID: 1077246802

View in Genome Browser
Species Human (GRCh38)
Location 11:1543694-1543716
Sequence CCCATCCTGCACTTGCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077246802_1077246804 -1 Left 1077246802 11:1543694-1543716 CCAGCTGGCAAGTGCAGGATGGG No data
Right 1077246804 11:1543716-1543738 GCAGAGTCCTTGTCCAGACCTGG No data
1077246802_1077246808 15 Left 1077246802 11:1543694-1543716 CCAGCTGGCAAGTGCAGGATGGG No data
Right 1077246808 11:1543732-1543754 GACCTGGGCAGAGAGCGCTCAGG No data
1077246802_1077246805 0 Left 1077246802 11:1543694-1543716 CCAGCTGGCAAGTGCAGGATGGG No data
Right 1077246805 11:1543717-1543739 CAGAGTCCTTGTCCAGACCTGGG No data
1077246802_1077246811 20 Left 1077246802 11:1543694-1543716 CCAGCTGGCAAGTGCAGGATGGG No data
Right 1077246811 11:1543737-1543759 GGGCAGAGAGCGCTCAGGGCAGG No data
1077246802_1077246809 16 Left 1077246802 11:1543694-1543716 CCAGCTGGCAAGTGCAGGATGGG No data
Right 1077246809 11:1543733-1543755 ACCTGGGCAGAGAGCGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077246802 Original CRISPR CCCATCCTGCACTTGCCAGC TGG (reversed) Intergenic
No off target data available for this crispr