ID: 1077246809

View in Genome Browser
Species Human (GRCh38)
Location 11:1543733-1543755
Sequence ACCTGGGCAGAGAGCGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077246800_1077246809 20 Left 1077246800 11:1543690-1543712 CCTGCCAGCTGGCAAGTGCAGGA No data
Right 1077246809 11:1543733-1543755 ACCTGGGCAGAGAGCGCTCAGGG No data
1077246802_1077246809 16 Left 1077246802 11:1543694-1543716 CCAGCTGGCAAGTGCAGGATGGG No data
Right 1077246809 11:1543733-1543755 ACCTGGGCAGAGAGCGCTCAGGG No data
1077246798_1077246809 23 Left 1077246798 11:1543687-1543709 CCACCTGCCAGCTGGCAAGTGCA No data
Right 1077246809 11:1543733-1543755 ACCTGGGCAGAGAGCGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077246809 Original CRISPR ACCTGGGCAGAGAGCGCTCA GGG Intergenic
No off target data available for this crispr