ID: 1077247984

View in Genome Browser
Species Human (GRCh38)
Location 11:1548375-1548397
Sequence CCGGGTGCAAACGCCCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077247975_1077247984 -3 Left 1077247975 11:1548355-1548377 CCCTGCTTCCCCAAACGTTTCCG No data
Right 1077247984 11:1548375-1548397 CCGGGTGCAAACGCCCCTCTGGG No data
1077247971_1077247984 29 Left 1077247971 11:1548323-1548345 CCCGCCCACTGTTGGGCAGGTTC No data
Right 1077247984 11:1548375-1548397 CCGGGTGCAAACGCCCCTCTGGG No data
1077247973_1077247984 25 Left 1077247973 11:1548327-1548349 CCCACTGTTGGGCAGGTTCTTGA No data
Right 1077247984 11:1548375-1548397 CCGGGTGCAAACGCCCCTCTGGG No data
1077247972_1077247984 28 Left 1077247972 11:1548324-1548346 CCGCCCACTGTTGGGCAGGTTCT No data
Right 1077247984 11:1548375-1548397 CCGGGTGCAAACGCCCCTCTGGG No data
1077247976_1077247984 -4 Left 1077247976 11:1548356-1548378 CCTGCTTCCCCAAACGTTTCCGG No data
Right 1077247984 11:1548375-1548397 CCGGGTGCAAACGCCCCTCTGGG No data
1077247974_1077247984 24 Left 1077247974 11:1548328-1548350 CCACTGTTGGGCAGGTTCTTGAC No data
Right 1077247984 11:1548375-1548397 CCGGGTGCAAACGCCCCTCTGGG No data
1077247970_1077247984 30 Left 1077247970 11:1548322-1548344 CCCCGCCCACTGTTGGGCAGGTT No data
Right 1077247984 11:1548375-1548397 CCGGGTGCAAACGCCCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077247984 Original CRISPR CCGGGTGCAAACGCCCCTCT GGG Intergenic
No off target data available for this crispr