ID: 1077250813

View in Genome Browser
Species Human (GRCh38)
Location 11:1559841-1559863
Sequence CCTGCCCTGCACCAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 395}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077250808_1077250813 1 Left 1077250808 11:1559817-1559839 CCACAGGCTGGTGGGAGGAAGTC 0: 1
1: 0
2: 1
3: 21
4: 271
Right 1077250813 11:1559841-1559863 CCTGCCCTGCACCAGCTGGAAGG 0: 1
1: 0
2: 2
3: 58
4: 395
1077250806_1077250813 7 Left 1077250806 11:1559811-1559833 CCGAGGCCACAGGCTGGTGGGAG 0: 1
1: 0
2: 5
3: 72
4: 470
Right 1077250813 11:1559841-1559863 CCTGCCCTGCACCAGCTGGAAGG 0: 1
1: 0
2: 2
3: 58
4: 395
1077250800_1077250813 23 Left 1077250800 11:1559795-1559817 CCACACACGTCCAAGTCCGAGGC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1077250813 11:1559841-1559863 CCTGCCCTGCACCAGCTGGAAGG 0: 1
1: 0
2: 2
3: 58
4: 395
1077250802_1077250813 13 Left 1077250802 11:1559805-1559827 CCAAGTCCGAGGCCACAGGCTGG 0: 1
1: 0
2: 4
3: 31
4: 271
Right 1077250813 11:1559841-1559863 CCTGCCCTGCACCAGCTGGAAGG 0: 1
1: 0
2: 2
3: 58
4: 395
1077250798_1077250813 27 Left 1077250798 11:1559791-1559813 CCTTCCACACACGTCCAAGTCCG 0: 1
1: 0
2: 1
3: 6
4: 65
Right 1077250813 11:1559841-1559863 CCTGCCCTGCACCAGCTGGAAGG 0: 1
1: 0
2: 2
3: 58
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077250813 Original CRISPR CCTGCCCTGCACCAGCTGGA AGG Intronic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900506582 1:3032433-3032455 CAGGCCCTGCACCAGGTGGTGGG - Intergenic
900585057 1:3428668-3428690 CCTGCCCTCCGCCATCAGGAAGG + Intronic
900592180 1:3465065-3465087 CCTGCACCCCAGCAGCTGGAAGG + Intronic
900629873 1:3628708-3628730 GCTGCCCTGCTGCTGCTGGAAGG + Exonic
900635770 1:3664288-3664310 CCTGCCCAGTACCAGCTGGCAGG + Intronic
900641841 1:3691309-3691331 CCTGCCCTGCCCCAGCTGCCAGG + Intronic
901638396 1:10680856-10680878 CCAGCCCTGCCCCAGTGGGAGGG - Intronic
901685696 1:10942218-10942240 CCAGCCCTTCTCCAGCTGGGTGG + Intergenic
901763087 1:11483170-11483192 TCCACTCTGCACCAGCTGGAAGG + Intronic
902082344 1:13829545-13829567 CCTGCTCTGGACTAGCAGGAAGG - Intergenic
902246233 1:15122622-15122644 CCTGCCCAGCCCCACCTGCAGGG - Intergenic
903217640 1:21852080-21852102 CCTGCCCGGCACCAGGTACAGGG - Exonic
903772110 1:25770517-25770539 TCTGCCTTTCACCAGCTTGATGG + Intronic
903968160 1:27102429-27102451 CCCGCTCTCCACCAGCTCGATGG + Exonic
904039819 1:27577332-27577354 CCTGCCGTGCGGCAGCTAGAGGG + Intronic
904274040 1:29368956-29368978 CCTGCCCTGTCAAAGCTGGATGG + Intergenic
904348584 1:29890327-29890349 CCTGCCCTGCATCACCAGCACGG + Intergenic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
906869877 1:49466493-49466515 TCGGCACTGCACCAGATGGAAGG - Intronic
909610395 1:77545843-77545865 TCTTCACTGCACCAGCAGGAGGG - Intronic
909774543 1:79467426-79467448 CCTGCCCTATACCAGGGGGAAGG - Intergenic
911102336 1:94104588-94104610 CTTCCCCTGCCCCAGCTGCATGG - Intronic
913192666 1:116426596-116426618 CCTACCCAGCACCAGCTGGGAGG - Intergenic
913243572 1:116851851-116851873 CCTGCAGTGCACCACCTGCAAGG - Intergenic
915315922 1:155029250-155029272 CTGGCCCGGCACCAGCTGCAGGG - Exonic
915604492 1:156941982-156942004 CCTGCCGAGCAACAGATGGATGG - Exonic
916745227 1:167680070-167680092 CCTGGCATGGCCCAGCTGGAAGG + Intronic
919977400 1:202621662-202621684 CCTGACCTGCTCCAGGTGGGAGG + Intronic
920346593 1:205309789-205309811 CCTGCCCTGGATCCTCTGGATGG - Intronic
920431302 1:205920962-205920984 CCTGCCCTGCGCCTGGTTGATGG + Intronic
922357876 1:224794066-224794088 CTTGCCTTGCTCCAGCTGGCAGG + Intergenic
922592243 1:226785958-226785980 CCTGCCCAGCCCCACATGGAAGG - Intergenic
922821611 1:228488625-228488647 CCTGCCCTGCCTGAGCCGGATGG - Intronic
1062860795 10:807657-807679 CCTGCCCTGGTGGAGCTGGAGGG - Exonic
1062888681 10:1038948-1038970 CCTGCCCTCCACCTGCTCCATGG - Intergenic
1064006829 10:11705430-11705452 CCTAGCCTGCCGCAGCTGGAGGG + Intergenic
1065847505 10:29758146-29758168 TCTGCCCTTCAGAAGCTGGAAGG - Intergenic
1066080576 10:31927985-31928007 GGTGCCCTGCCCCTGCTGGATGG - Intronic
1067432548 10:46253507-46253529 CCTCCCCTTCAGCAGCAGGAGGG + Intergenic
1067440711 10:46307940-46307962 CCTCCCCTTCAGCAGCAGGAGGG - Intronic
1069645879 10:69997196-69997218 CCTGCCCTGCATCATCTAGATGG + Intergenic
1073571238 10:104582743-104582765 CCTCCCCTGCACCTGCTGTGAGG + Intergenic
1075198691 10:120383158-120383180 ACTGGCCTGCACTAGCAGGATGG + Intergenic
1075274562 10:121081498-121081520 CATGCCATCCACCAGCTGGCTGG - Intergenic
1075783968 10:125035780-125035802 TGTGAACTGCACCAGCTGGAGGG - Intronic
1076137780 10:128056823-128056845 GGTGACCTGCTCCAGCTGGATGG + Intronic
1076221092 10:128733749-128733771 CCCGCCCTGCAGCAGGTGCATGG - Intergenic
1076338660 10:129727957-129727979 CCTCCCCTGCTCCAGCCAGAAGG - Intronic
1076555033 10:131316005-131316027 CCTGCTCTGCACCAGCTTCTGGG - Intergenic
1076699049 10:132260751-132260773 CGTGCCCATCACCACCTGGAGGG + Intronic
1076746574 10:132517615-132517637 CCTGCCCTGCCCCCACCGGAGGG - Intergenic
1076794352 10:132791448-132791470 CCTGCCCGGAACTAGATGGAGGG + Intergenic
1077039473 11:512793-512815 CCTGCCCTCCATCAACTAGAAGG - Intergenic
1077142410 11:1030386-1030408 CCTGCCCCACCCCAGCTTGATGG + Intronic
1077164629 11:1129514-1129536 GGGGCCCTGCAGCAGCTGGACGG - Intergenic
1077212398 11:1377580-1377602 CGTGCACTGCTCCAGCTGGCCGG - Intergenic
1077250813 11:1559841-1559863 CCTGCCCTGCACCAGCTGGAAGG + Intronic
1077352573 11:2099725-2099747 TCTGCCCTGTGCCAGCTGGCAGG - Intergenic
1079251399 11:18790647-18790669 CCAGCCCTGCCCCACTTGGAGGG - Intronic
1081547680 11:44083355-44083377 ACTGCCCCTCACCTGCTGGAGGG - Intronic
1081792462 11:45797959-45797981 TCTGCCCTTCAACAGCAGGACGG + Intergenic
1081906272 11:46672420-46672442 CCTGCTCTGAGCCAGGTGGAAGG + Exonic
1083285128 11:61653715-61653737 CCTGCCCGATACCTGCTGGAAGG + Intergenic
1084019622 11:66409793-66409815 CCTGCCCTGCACCAAGCAGAGGG + Intergenic
1084411366 11:69008063-69008085 CCTGCTGTGCTCCAGCTGGTGGG + Intronic
1084457609 11:69277596-69277618 CCTGCCCTGCATCAACCGGCTGG - Intergenic
1084582166 11:70030823-70030845 CCACCCCTCCACCAGCTGGAAGG + Intergenic
1085038283 11:73312501-73312523 TCTGCACAGTACCAGCTGGATGG - Intronic
1085517171 11:77118377-77118399 CCTGCCCTGTAGCAGCTGCGGGG + Intronic
1089137528 11:116261804-116261826 CCCCCCCGGCACCAGATGGAGGG - Intergenic
1089625515 11:119748529-119748551 CCTCACCTGGCCCAGCTGGAGGG + Intergenic
1089694825 11:120210722-120210744 CCCGTCCTGCCCCTGCTGGAAGG + Intergenic
1090355227 11:126136054-126136076 CCTCCCCTGCACCCCCTGCAAGG + Intergenic
1090541256 11:127708615-127708637 CTTGCCCTGGAAAAGCTGGAGGG - Intergenic
1091791323 12:3273777-3273799 CCTGCCCCGCACAGGCAGGAGGG - Intronic
1092111749 12:5969413-5969435 CCAGCCCTGCCCCAGCTTGTTGG - Intronic
1092947355 12:13469103-13469125 TCTCTCCTCCACCAGCTGGAGGG - Intergenic
1095690281 12:45080870-45080892 CCTACCAAGCACCAGCTGGTGGG - Intergenic
1095830955 12:46586056-46586078 CCTGCCTTGCTGCAGCTGGATGG - Intergenic
1095964340 12:47857048-47857070 CCTGCCCTGGGGCTGCTGGATGG - Intronic
1096080223 12:48828016-48828038 CCTGCCCAGCCCCAGCTTCAGGG + Exonic
1096397169 12:51275075-51275097 CCTGCCCTCCAGCAGTTTGAAGG - Intergenic
1096461622 12:51824627-51824649 CCTGCTCGGCAAGAGCTGGAGGG - Intergenic
1096650322 12:53059237-53059259 CCTGCCGTTCAGCAGCTGTAGGG - Exonic
1097156912 12:57018632-57018654 CCTGCCCCACACCAGAAGGAAGG + Intronic
1097186539 12:57199379-57199401 CATGCCCTGCGCCAGCCAGACGG + Exonic
1098202885 12:68075647-68075669 CTTGGCCTGGACCACCTGGAGGG - Intergenic
1098235730 12:68416494-68416516 CAGGCCCCGCACAAGCTGGATGG + Intergenic
1102731604 12:115116096-115116118 CCTGCCCTGTCCTTGCTGGATGG + Intergenic
1102756777 12:115347978-115348000 CCTACCCTCCACCTGCTGGGGGG - Intergenic
1103006001 12:117420851-117420873 CCAGCCCTGTACCAGCTGTAGGG - Intronic
1103271911 12:119680449-119680471 CCTGCCCTGGTCCTGCTTGAAGG + Exonic
1104015622 12:124959931-124959953 CCTGCCCTGGAGCAGGGGGAGGG + Intronic
1104236079 12:126937753-126937775 CCTGCCCTTCTCCATCTGCATGG - Intergenic
1105328018 13:19387814-19387836 CCTGCCCTACATGAGCTGGCAGG + Intergenic
1105863888 13:24441875-24441897 CCTGCCCTACATGAGCTGGCAGG - Exonic
1106026470 13:25960248-25960270 CATCCTCTGCTCCAGCTGGACGG - Intronic
1107016948 13:35715004-35715026 CCAGCCACACACCAGCTGGAGGG - Intergenic
1112582453 13:100688190-100688212 CCTGTCCTGCATCAGATGGATGG - Intergenic
1113008676 13:105737929-105737951 CCTGCCCAGCACCAGCAGGTAGG + Intergenic
1113107386 13:106786316-106786338 CCTTCCCTGCACCAGCACAAGGG - Intergenic
1113961608 13:114129412-114129434 CCTCACCTGCAAGAGCTGGAAGG + Intronic
1114530581 14:23393050-23393072 TCTTCCCTCCAACAGCTGGAGGG - Exonic
1114535905 14:23422318-23422340 CCTTCTCTCTACCAGCTGGAAGG - Exonic
1118030260 14:61812285-61812307 CATGCTCAGCCCCAGCTGGAAGG - Intergenic
1119294422 14:73521427-73521449 CCTGTCCACCACCAGGTGGATGG - Intronic
1119852963 14:77879129-77879151 GCTCCCCTGGATCAGCTGGAGGG + Intronic
1121685913 14:95834939-95834961 GCTTCTCTGCACCTGCTGGAGGG + Intergenic
1122207763 14:100156705-100156727 CCAGACCTGGCCCAGCTGGATGG - Intronic
1122838583 14:104443416-104443438 CCTGCCCCTCACCTGCTGGAAGG + Intergenic
1122894510 14:104749762-104749784 CCTGCCCTGCATCAGATTGATGG - Intergenic
1123032052 14:105456533-105456555 CCGGCCCCACACCAGCTGGTGGG - Intronic
1123205257 14:106706627-106706649 CCTCCTGTGCACCAGCTGCAGGG + Intergenic
1123210302 14:106753894-106753916 CCTCCTGTGCACCAGCTGCAGGG + Intergenic
1123432173 15:20227433-20227455 CCTAACCAGCACCAGCTGGTTGG - Intergenic
1124244895 15:28060268-28060290 CCTGCAGTGCCCCAGCTAGAGGG - Intronic
1124493058 15:30170035-30170057 CCTGACCTGCTCCAGGTGGGAGG + Intergenic
1124750476 15:32368290-32368312 CCTGACCTGCTCCAGGTGGGAGG - Intergenic
1124896879 15:33785697-33785719 CCTGACATCCCCCAGCTGGAAGG + Exonic
1125732498 15:41901026-41901048 GCCGCCCTGCACCAGCTGCGTGG + Exonic
1126453370 15:48834627-48834649 CATGTCCTGCTCCAGCTGGAAGG + Intronic
1126670406 15:51110698-51110720 CCTGCCCTGCACAAGCAGTGGGG + Intergenic
1128262255 15:66240717-66240739 TCTGCCATGCACTAGCTGCATGG - Intronic
1129110132 15:73332359-73332381 CCTGCCCTGGAGCTGCTGGTGGG + Intronic
1129254902 15:74328738-74328760 CCTGCCATGCAGCAGGTGGGAGG + Intronic
1129897989 15:79122786-79122808 CTTCCCCTGCACCCCCTGGAGGG - Intergenic
1130322610 15:82853511-82853533 CCTGCCCTGCCCGACCTGGAGGG - Intronic
1130682578 15:86009600-86009622 GCTCCCCTGCACCTGCGGGAAGG + Intergenic
1131308814 15:91269273-91269295 CCTGCCCTGATCCATCTTGAGGG - Intronic
1131371408 15:91885133-91885155 CCTGCTCTGCGTCACCTGGAAGG + Intronic
1131419258 15:92290537-92290559 CCTGCACTGCAGCAGCTTGAGGG - Intergenic
1132602883 16:781780-781802 CCTGCCCAGCAGCAGCAGGACGG - Intronic
1133113778 16:3564649-3564671 CAGGCCCTCCACCAGCAGGAGGG + Exonic
1133178230 16:4032367-4032389 CCTGCCCTCCACCTGCCGCAGGG - Intronic
1133832443 16:9335941-9335963 GCTGCCCAGCACCAGCAGGATGG - Intergenic
1134054426 16:11160549-11160571 GCTGCCCTGTACCTGCTGGGTGG - Intronic
1135186841 16:20322819-20322841 CCTGCCCTGCCCCCTCAGGATGG + Intronic
1136614275 16:31387110-31387132 CCTGCCCTGCATCAGTAGAATGG + Intergenic
1136852465 16:33623706-33623728 CCTAACCAGCACCAGCTGGTTGG + Intergenic
1137441855 16:48504763-48504785 CCTGCCCTGCGGAAGCTGGTGGG + Intergenic
1137705884 16:50535632-50535654 CCTGTCCTGCACCTGGTGCATGG + Intergenic
1137985159 16:53100981-53101003 ACTGCCCTGTACCATCTGAAAGG + Intronic
1139653741 16:68375316-68375338 CCTGGGCTCCACCAGCAGGAAGG + Intronic
1141623123 16:85247665-85247687 CCTGCCCAGGGCCAGCTGGCCGG - Intergenic
1141643062 16:85352698-85352720 CCTGCTCAGCACCATCTTGAAGG - Intergenic
1141657717 16:85424978-85425000 CCTGCCCTGCTCCAGCTGCCTGG - Intergenic
1141856159 16:86682793-86682815 CCTGCCCTCCACCACATGCAGGG + Intergenic
1142271236 16:89090532-89090554 CATGACATGCACCTGCTGGAAGG + Intronic
1203114065 16_KI270728v1_random:1472174-1472196 CCTAACCAGCACCAGCTGGTTGG + Intergenic
1142597331 17:1035952-1035974 CCTGCCCTGTGCGAGCGGGAGGG + Intronic
1143662735 17:8336749-8336771 TCTCCCCTCCAGCAGCTGGAGGG + Intergenic
1143837030 17:9700905-9700927 CCTGCCCTGTAGGAGCTGGTGGG + Intronic
1143837217 17:9701876-9701898 CCTGCCCTGTAGGAGCTGGTGGG + Intronic
1144676552 17:17165922-17165944 CCTCTCCTGCTCCAGCTGGGAGG - Intronic
1146885095 17:36465098-36465120 CCTGCCCTCCCGCAGCTGGAAGG - Intergenic
1147141972 17:38465195-38465217 CCGGCCCTGTGCCAGCTGGAGGG + Intronic
1147190046 17:38733219-38733241 CCTGCCCTGCCCCAGCAGGTGGG + Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148053731 17:44781413-44781435 CCCGCCCTGCATCAGCTTGCAGG - Exonic
1148462790 17:47847889-47847911 GCTGCCCTCCGGCAGCTGGAAGG + Exonic
1148776340 17:50097543-50097565 CCAGCTCTGCACCAGCTGCACGG - Exonic
1148807363 17:50270709-50270731 CCTGCCGGGGCCCAGCTGGAAGG - Intergenic
1148818288 17:50346208-50346230 CAGGCCCTGCAGCAGCAGGATGG - Exonic
1149950182 17:60977065-60977087 GCTGCCCTGCACCTCCCGGACGG + Intronic
1151277854 17:73049405-73049427 CCTGCCCTGCTGCTCCTGGAAGG - Intronic
1151476215 17:74345564-74345586 CCAGACCTACACCAGCTGGGTGG - Intronic
1151539701 17:74758761-74758783 CCAGCCCTGCCCCAGCTTGGCGG + Intronic
1151658745 17:75507895-75507917 CCTCCCCTGGGCCAGCTGGGAGG - Intronic
1152204468 17:78967244-78967266 GCTGCCCTCCATGAGCTGGAAGG + Intergenic
1152279288 17:79375855-79375877 CCTGCCCCACACCAGCTGTGTGG + Intronic
1152581972 17:81169612-81169634 CCTCCCCTGGAGCATCTGGAGGG - Intergenic
1152703846 17:81833048-81833070 CCCGCCCGGCACCTGCAGGAGGG - Intronic
1152852196 17:82643863-82643885 CCTTCCCTGCTCCACCTGCAAGG + Intronic
1153819977 18:8824771-8824793 CCTGCCGTCCACCAGCAGCAAGG + Exonic
1155923972 18:31634083-31634105 TATGCCCTGCCACAGCTGGAGGG + Intronic
1156308024 18:35897213-35897235 CCTGCCCTGGACCAGTGTGAGGG + Intergenic
1156309269 18:35907790-35907812 CCTGGCCTGCAACACCTGGGAGG - Intergenic
1157194053 18:45606054-45606076 CCTCCCCGCCTCCAGCTGGATGG - Intronic
1157451384 18:47791727-47791749 GCTGCTCTGCAACAGCTGGAGGG + Intergenic
1157493932 18:48142249-48142271 CCTGTCCTGCAGGGGCTGGAAGG + Intronic
1157569225 18:48701253-48701275 CCTGGTCTGCAGCAGCTTGAAGG + Intronic
1158585383 18:58728780-58728802 CCAGCCCTGCAACTGCTGAATGG - Intronic
1160445210 18:78922249-78922271 CCAGACCTGCACCACGTGGAAGG - Intergenic
1160455035 18:78993791-78993813 CCTGCCCTGCACCAACGCCAGGG + Exonic
1160854847 19:1212121-1212143 CCAGGCCTGCCCCAGCTGGCTGG - Intronic
1161014908 19:1978740-1978762 CCCGCCGCGCACCAGCTGGATGG - Exonic
1161048798 19:2151308-2151330 GCTGCCCTTCACCATCTTGAGGG + Exonic
1161271615 19:3392753-3392775 CCTGCCCTCGCCCAGCTGGAGGG - Intronic
1161542124 19:4858331-4858353 CCTGCCCCTCAGCAGCTGGGTGG - Intronic
1161793916 19:6375784-6375806 CCAGCCCTGTCCCAGCTGCAGGG + Exonic
1162222752 19:9192123-9192145 AGTGCCCTGCAGCAGCTGCATGG + Intergenic
1162451332 19:10756942-10756964 TCTGCCCTGCATCAGCCAGAGGG + Intronic
1162488389 19:10976323-10976345 CCAGCCCTGTAGAAGCTGGATGG - Intronic
1162735651 19:12745602-12745624 CATGCCCTTCACCAGCCTGAGGG - Exonic
1162844179 19:13379592-13379614 CCTGCTCTTTACCACCTGGAAGG + Intronic
1162909499 19:13841694-13841716 GCAGTCCTGCCCCAGCTGGAGGG - Intergenic
1165008326 19:32824323-32824345 CCAGCCCTGCTGCAGCTGGTCGG + Intronic
1165826338 19:38708102-38708124 CCTTTCCTTCCCCAGCTGGAAGG + Exonic
1165832845 19:38737661-38737683 CCTGCCCGGCCCCACCTCGAGGG + Intronic
1166325271 19:42046112-42046134 ACTGCCCTGCTTCAGCTGGGTGG - Intronic
1166871247 19:45872391-45872413 CTTGCCCGGCGCCTGCTGGATGG - Exonic
1167288926 19:48614193-48614215 CCTCCACTGCAGCAGCTGGAAGG - Intronic
1167457634 19:49605774-49605796 CCTGCCCCGTGCCAGCTGGGAGG - Intronic
1167652417 19:50739778-50739800 CCCGCCCTGGACTGGCTGGATGG + Intergenic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
1168014256 19:53558602-53558624 CCTGCCCTGTACCTGTAGGAAGG - Intronic
1168085765 19:54044715-54044737 CATGCCCTTCACCAGTGGGAGGG - Intronic
1168137155 19:54359562-54359584 CCCGCTCTGCACCTGATGGAGGG - Intronic
1168160921 19:54509523-54509545 CCCGCTCTGCACCTGATGGAGGG + Intronic
1168170538 19:54585515-54585537 CCTGCGATGCTGCAGCTGGATGG - Intronic
1168713341 19:58513841-58513863 CCAGCCCGGCACCACCTGGAGGG + Exonic
924999548 2:394048-394070 TCTGCCCAGCACCTCCTGGAGGG - Intergenic
925348454 2:3186079-3186101 CCTGCCATCCACCAGCTGCCAGG + Intergenic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
927637688 2:24828018-24828040 GCTGACCTGCACCAGCATGATGG + Exonic
927812496 2:26187740-26187762 ACTGCCCTGCCCCAGCTCAAAGG - Exonic
927918216 2:26950125-26950147 CCTGCGCCTCAGCAGCTGGAGGG - Exonic
927919983 2:26964893-26964915 CCTGCCCTGCCCCGGCTGTGAGG - Intergenic
928093112 2:28388345-28388367 CCTTCCCTCTACCTGCTGGATGG + Intergenic
928378378 2:30797658-30797680 ACAACCCTGCACCAGCTGGTGGG + Intronic
928437689 2:31266310-31266332 TCCGCCCTTCACCATCTGGATGG - Exonic
928573016 2:32627543-32627565 ACTTCCCTGCACCAGCGGCAGGG + Intergenic
929789136 2:45010863-45010885 CCTGGCCTGCAGCAGCTGAGGGG - Intergenic
929828119 2:45326045-45326067 CCAGTCCTGCAACAGCAGGACGG - Intergenic
931991574 2:67795815-67795837 CCTGCCCTTGACTAGCTAGAAGG + Intergenic
932265734 2:70365633-70365655 CCTGCCTCTCACCACCTGGAGGG + Intergenic
932276972 2:70458848-70458870 CCTGCCCTGCAAGAGCAAGAAGG - Intronic
932364927 2:71144735-71144757 CATGCCCAGCCCCAGCTGGCAGG - Intronic
932800793 2:74740832-74740854 CCTGCCCTGCTCCAGGCAGAAGG + Intergenic
932887115 2:75558555-75558577 CCTGCCCTGCCCCAGGTTGGGGG - Intronic
934553996 2:95277945-95277967 CATGTCCTGCACCAGCTAAAAGG + Exonic
934855577 2:97727383-97727405 CCTGCCCTGCTGCATCTGGAGGG + Intronic
935211539 2:100943154-100943176 TCTGCCCTGCACCAGCAAGGTGG + Intronic
935498740 2:103812238-103812260 CTTGTGCTGCACCTGCTGGAAGG - Intergenic
936087301 2:109477943-109477965 CCTGCCCTGCCTTTGCTGGAGGG + Intronic
936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG + Intergenic
936197736 2:110384821-110384843 CCAGCCCAGCACCACCTGGAAGG - Intergenic
936535575 2:113308532-113308554 CCTGCCGTGTTCCAGCAGGAAGG - Intergenic
936649865 2:114413724-114413746 CCTGCGATGCTGCAGCTGGATGG - Intergenic
936783071 2:116057491-116057513 CCTGCCCTCCACCACCCAGATGG - Intergenic
937857623 2:126683962-126683984 GCTGCACTGCACCATCTGGATGG - Intronic
938039304 2:128062690-128062712 ACTGCCATGCACCAGCCAGAAGG + Intergenic
938268459 2:129947380-129947402 CCTGACCTACACCAGCAGGTGGG - Intergenic
938292236 2:130156371-130156393 CCTGCCCTGCACCAGACAGGTGG + Intronic
938464313 2:131516596-131516618 CCTGCCCTGCACCAGACAGGTGG - Intergenic
938548115 2:132353247-132353269 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
939956949 2:148535184-148535206 TCTGCCCCTCACCAGCTGTAAGG + Intergenic
939959041 2:148550040-148550062 GCTACCCTGCCTCAGCTGGAGGG + Intergenic
941557831 2:167005359-167005381 CATGGGCTGTACCAGCTGGAGGG + Intronic
942851625 2:180494532-180494554 CCTTCCCTTCCCCAGCTGGGTGG + Intergenic
947519325 2:230831771-230831793 CCATCCCTGCACCAGATGGAGGG + Intergenic
947744541 2:232500808-232500830 ACTGCCCTGGAGCAGCTGGCTGG - Intergenic
947860263 2:233353471-233353493 CAAGCCCTGCTCCACCTGGATGG + Intergenic
948458337 2:238117562-238117584 ACAGCCCTGCAGCAGCCGGAAGG + Intronic
948840430 2:240646074-240646096 CCTGCCCTTCTCCACCTAGAGGG - Intergenic
948846457 2:240685085-240685107 CCTGCCCTTCCGCAGCGGGAGGG + Intergenic
948846502 2:240685232-240685254 CCCGCCCTTCCCCAGCGGGAGGG + Intergenic
948847360 2:240689501-240689523 CCCGCCCTTCCCCAGCGGGAGGG - Intergenic
948847405 2:240689648-240689670 CCTGCCCTTCCGCAGCGGGAGGG - Intergenic
948858576 2:240742091-240742113 CTGGCTCTGCAGCAGCTGGAGGG + Intronic
948896212 2:240928994-240929016 CTGGCCATGCACCCGCTGGAGGG - Intronic
1169091352 20:2863079-2863101 CCTGTCCAGCAGCACCTGGATGG - Exonic
1169203557 20:3727891-3727913 CCTTCCTTGAAACAGCTGGAGGG - Intergenic
1170408351 20:16063232-16063254 CCTCCCCTGCTCCATGTGGAGGG - Intergenic
1170593289 20:17787279-17787301 CCTGCCCTGCAGCCTTTGGAGGG - Intergenic
1170608901 20:17895495-17895517 CCTGCCCACCCCCACCTGGAAGG + Intergenic
1171183473 20:23108311-23108333 CATCCCATGCTCCAGCTGGAGGG + Intergenic
1171876984 20:30586019-30586041 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1172104488 20:32508549-32508571 CCTGCCTTTCACCACCTGGCAGG - Intronic
1172271698 20:33658851-33658873 CCGGCCCCGCACCAGCTGACCGG - Intronic
1172689231 20:36778998-36779020 CCTGCCCTTCACCAGCTTTCTGG - Exonic
1173945077 20:46944090-46944112 CCTGCTCTGCTCCCCCTGGATGG + Intronic
1174265317 20:49327275-49327297 CCAGCCCTGGGCCAGTTGGATGG - Intergenic
1174566003 20:51464847-51464869 CTTGCCCCTCACTAGCTGGATGG + Intronic
1174951696 20:55049304-55049326 CCTGCCTCCCACCAGCGGGAAGG + Intergenic
1175742391 20:61429288-61429310 TCTGCCTTTCACCAGCTGCATGG - Intronic
1175816998 20:61888367-61888389 CCTCCCTTGCAGCGGCTGGACGG - Intronic
1176132921 20:63503802-63503824 CCTGCCCTGGCCCAGCTGCTCGG - Intergenic
1176139592 20:63539146-63539168 CCTGCCCAGCTCCATCTGCATGG - Intergenic
1176173903 20:63708680-63708702 GCTGACCTGCGCCAGCTGCAGGG + Exonic
1176369078 21:6051822-6051844 TCTGCCCCGCTCCTGCTGGATGG + Intergenic
1176519748 21:7815710-7815732 CATTCCCTGCTCCATCTGGATGG + Intergenic
1176519847 21:7816145-7816167 CATTCCCTGCTCCATCTGGACGG + Intergenic
1177876858 21:26644268-26644290 TCTGCCCTGCACCATCAGGTAGG - Intergenic
1178653776 21:34445723-34445745 CATTCCCTGCTCCATCTGGATGG + Intergenic
1178653875 21:34446158-34446180 CATTCCCTGCTCCATCTGGACGG + Intergenic
1179681121 21:43022044-43022066 CCTGCCCTGGATCAGCAGGCTGG - Intronic
1179754441 21:43486719-43486741 TCTGCCCCGCTCCTGCTGGATGG - Intergenic
1180758766 22:18182890-18182912 CCTGCCCTCCCCCAGTTGGTAGG - Intergenic
1180809978 22:18753023-18753045 CCTGCCCTCCCCCAGTTGGTAGG + Intergenic
1180826928 22:18869906-18869928 CCTGCCCTCCCCCAGTTGGTAGG - Intergenic
1181196122 22:21187275-21187297 CCTGCCCTCCCCCAGTTGGTAGG + Intergenic
1181213405 22:21305849-21305871 CCTGCCCTCCCCCAGTTGGTAGG - Intergenic
1182425247 22:30268137-30268159 CCTGAGCTGCTCCAGCTGGAGGG + Intergenic
1183265572 22:36823206-36823228 CCTCCCCTCCACCAGCTGGGAGG - Intergenic
1183515680 22:38264490-38264512 CATACCCTGCACAAGCTGCAGGG + Intronic
1183619632 22:38964957-38964979 CCGTCCCTGGGCCAGCTGGAGGG - Intronic
1183686386 22:39363512-39363534 CCTCCCCAGCACCAGCTGCTGGG - Intronic
1184114562 22:42414813-42414835 CCTGCCCAGGACAAGCAGGAAGG - Intronic
1184849531 22:47112358-47112380 CAGGCTCTGCACCAGCTGGCTGG + Intronic
1185057538 22:48588694-48588716 CCTGCCCTGCCCCAACCGGGAGG - Intronic
1185259027 22:49851480-49851502 GCTGCCCTGCACAATTTGGAAGG + Intergenic
1185285529 22:49998137-49998159 TCTGCGATGCACCAGCTGGCTGG + Exonic
1185365829 22:50436306-50436328 GGTGCCCTGCACCATCTGCACGG + Intronic
1203230676 22_KI270731v1_random:107566-107588 CCTGCCCTCCCCCAGTTGGTAGG - Intergenic
950196224 3:11011077-11011099 CCAGCCCTGGACCAGATGGCAGG - Intronic
950525520 3:13520681-13520703 CCTGCCCTGCACATGCTGTGTGG + Intergenic
950678468 3:14568890-14568912 TCTGCCCTTCACCAGCTGTGTGG + Intergenic
950881203 3:16323849-16323871 ACTGTCCTGTAGCAGCTGGAGGG - Intronic
951054815 3:18135502-18135524 CCTGCCCTGCACCAGGTCTGTGG + Intronic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
953912607 3:46900496-46900518 CCTGGCCTGCGCCAGCTCAAGGG - Intronic
954321229 3:49833263-49833285 CCTGCCTTGAGCCACCTGGAGGG - Intronic
960943839 3:122952726-122952748 CCTGCTCTGCGCCAGCAGGGAGG + Intronic
961211943 3:125132142-125132164 CATGCTCTGCACCAGCTCCAGGG - Intronic
962311911 3:134332675-134332697 TCTGCCCTGCTCCAGCTGCCTGG + Intergenic
962603342 3:137011667-137011689 ACAGCCCTTCACCACCTGGAGGG + Intergenic
964430354 3:156599342-156599364 TCTGCCTTGCCCCAGCTGCAGGG - Intergenic
966921778 3:184616711-184616733 CCTGCCCTGCATCAACTGAATGG + Intronic
968000240 3:195200625-195200647 CCTGCCCTGCACAGGCTGTGAGG - Intronic
968527881 4:1073466-1073488 CCTCCCATGCACCGGGTGGAAGG + Intronic
968914611 4:3491989-3492011 CCTGCCCTGCCCCAGGAGGAGGG + Intronic
969566487 4:7981841-7981863 ACTGCCCTGCACTAGCTGGCTGG - Intronic
977572717 4:98646221-98646243 CTAGCTCTGCATCAGCTGGAAGG + Intronic
977771710 4:100868526-100868548 CCTGCTATGCTGCAGCTGGAAGG - Intronic
977928863 4:102730335-102730357 CCTTCCCTGTGCCACCTGGAGGG + Intronic
978382535 4:108144657-108144679 CCTGCCCTCCAGCAGCTGTGTGG - Intronic
978600180 4:110419239-110419261 CCCGCCCTGCCCCAGACGGAGGG - Intronic
979860325 4:125685583-125685605 CCTGCCCTGCACCAGGTTCTAGG + Intergenic
983247557 4:165305704-165305726 CCTGCCCTGCACCTCCTGGAAGG - Exonic
984024512 4:174526840-174526862 CCTGTGCTGCGTCAGCTGGAAGG + Intergenic
985569836 5:638942-638964 CCAGCCCTGAGCCAGGTGGAGGG - Intronic
985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG + Intergenic
985785791 5:1893457-1893479 CCATCCCTGCACAAGCTGGTGGG + Intergenic
985810060 5:2076097-2076119 CCTGCCAGGCCCCAGATGGATGG + Intergenic
985820368 5:2156052-2156074 CCTGCCCTGGAGCCGCTGGAGGG - Intergenic
986704493 5:10443902-10443924 ACTGCCCTGGACTATCTGGATGG - Intronic
990954797 5:61331535-61331557 GCTCCCCTGGACCGGCTGGAGGG + Intergenic
991049414 5:62256440-62256462 CCTAACCAGCACCAGCTGGTTGG - Intergenic
992508425 5:77410058-77410080 CCTGTCCTGCATCAGCAGCAGGG - Intronic
992944794 5:81799572-81799594 CCTTCCCTGTTCCAGCAGGAAGG + Intergenic
996341291 5:122441630-122441652 CCTGCCATGCACTACTTGGATGG - Intronic
996869216 5:128168171-128168193 TCTGCTCAGCAACAGCTGGAGGG - Intronic
997230522 5:132239130-132239152 CCTGCCCTGCAGCTTCTGGTTGG + Intronic
997714115 5:136029333-136029355 CCAGCCCTGCACGCGGTGGAAGG + Intronic
997887113 5:137639859-137639881 CCTGCTCTGCATCTTCTGGAAGG + Exonic
998736229 5:145144441-145144463 CCTGCCAGGCACCAGAGGGAAGG + Intergenic
999937250 5:156500932-156500954 CTTACCCTGCACCAGTGGGAAGG + Intronic
999978585 5:156936964-156936986 CCAGTCCTGTACCACCTGGATGG + Intronic
1000120936 5:158197220-158197242 CCTGCCCAGCAGCAGCGGGCTGG - Intergenic
1001368427 5:171169296-171169318 CCTGCCAGTCACCAGCTGTATGG - Intronic
1002074181 5:176698334-176698356 CCTGTTCTGTCCCAGCTGGAGGG - Intergenic
1002120095 5:176996747-176996769 ACTGCACTGCAACAGCTGAAGGG + Intronic
1003268812 6:4589598-4589620 CCTGCACTGCTCCAGCTAAAGGG + Intergenic
1003913853 6:10767087-10767109 ACTGCCCTGCAAGAGCGGGAGGG + Intronic
1004890774 6:20098284-20098306 CGTGCTCTGCACCAGGTGGTGGG + Intergenic
1007337392 6:41163334-41163356 CCTGGCTGGCACCAGCAGGAGGG - Intergenic
1007762000 6:44138753-44138775 CCTGCCCTGCCCCACCTTGAGGG + Intronic
1008774242 6:55016920-55016942 CTTGGCCTGAGCCAGCTGGAAGG - Intergenic
1014109251 6:117602250-117602272 CATGCCCAGCAGCAGCCGGAGGG - Exonic
1014293300 6:119586684-119586706 GCGGCCCTGCAGCAGCTGGCAGG + Intergenic
1015886575 6:137924241-137924263 CTTTCCCTCCACCAGCTGTAAGG + Intergenic
1016980544 6:149850013-149850035 CCTGCTCTCCACCATCTGCACGG - Intronic
1018837944 6:167498976-167498998 CCTGCCCAGGACCTGCTGGCCGG - Intergenic
1018905263 6:168072205-168072227 CCTGCCCTGCACCCCCTGCTGGG + Intronic
1018927290 6:168215214-168215236 CCTGCCCTGCACGAGCCGCCTGG + Intergenic
1019070165 6:169338960-169338982 CCTGGCCTGCCACAGCTAGAGGG + Intergenic
1019147200 6:169983094-169983116 CCTGCCCAGCCCCTCCTGGAAGG + Intergenic
1019182926 6:170203125-170203147 CCTGGTCTGCACAAGCTGGAAGG + Intergenic
1019740124 7:2668630-2668652 GCTGTCCTGGACCAGCTGGAGGG - Intergenic
1020244351 7:6419390-6419412 CCTGCCCAGCACCAGCCACAGGG - Intronic
1024054520 7:45651376-45651398 CCTGCCTTGCACATGCAGGATGG + Intronic
1024117582 7:46208481-46208503 GCTGCACTGCACCTTCTGGAAGG + Intergenic
1026878111 7:73891376-73891398 CCTGACCTGGTCCAGCCGGAGGG + Intergenic
1029033198 7:97490502-97490524 CCCGCCCTGCACCTGGTTGATGG - Intergenic
1029159921 7:98544296-98544318 TCTGCCCTGCAGCACCTGGGTGG + Intergenic
1029355717 7:100049993-100050015 CCCGCCCAGGACCAGCTGGTGGG + Intronic
1029523185 7:101077480-101077502 CCTGCCCTTCTCCAGCTGCCTGG + Intergenic
1029680672 7:102106878-102106900 CCTGCCCTGCAGCATCATGAAGG + Intronic
1031347762 7:120690568-120690590 CCTGCCCTTCACCAGGTGAATGG - Intronic
1034200910 7:149282310-149282332 CCTGCCCTGGCCCAGCCGGAAGG + Exonic
1035224655 7:157426631-157426653 CCTGCTCGCCACCAGCTGGGAGG - Intergenic
1037528373 8:19749979-19750001 GCTGTGCTGCACCAGCTGGATGG - Intronic
1037813096 8:22098170-22098192 CCTGCCAGGCCCCAGCTGGACGG + Exonic
1037819229 8:22127684-22127706 CCTTCACTGCACCAGAGGGATGG - Exonic
1040531483 8:48269926-48269948 CCTCCCTTGCACAAGCTTGATGG + Intergenic
1041381418 8:57257951-57257973 CCTGCCCTCCTGCAGCTGCAGGG - Intergenic
1041437557 8:57859196-57859218 CCTGACCTGCAGCTGCTGGCAGG + Intergenic
1043491468 8:80753305-80753327 CTTGCCCTCCTCCAGCAGGAAGG - Intronic
1047766119 8:127991520-127991542 CATGCCCTGCTGCACCTGGAGGG + Intergenic
1047953251 8:129953240-129953262 CCTGACCTTCCCAAGCTGGAAGG - Intronic
1049059056 8:140261875-140261897 CCTGCCCAACACAACCTGGAAGG + Intronic
1049291732 8:141806912-141806934 CCTCCCAGGCCCCAGCTGGATGG - Intergenic
1049323667 8:142010752-142010774 CCTGCTCTGAACCAGCAGAACGG - Intergenic
1049388054 8:142354195-142354217 TCTGCCCTGCACCAGCTGCGCGG + Intronic
1049432203 8:142570358-142570380 CCTGACCCTCACCAGCTGGCTGG + Intergenic
1049507479 8:143011162-143011184 CCTGGTCTCCACCATCTGGAGGG - Intergenic
1049693940 8:143974594-143974616 CCTGACCTGTTCCAGCCGGAGGG - Intronic
1049707395 8:144049239-144049261 TGGGCCCTGCACCAGCTGCAGGG + Intergenic
1050206798 9:3204881-3204903 CCTGCCCTACACTAGGAGGAAGG + Intergenic
1050595538 9:7200827-7200849 CCCGCCCCGCAACAGCTGGTTGG + Intergenic
1052627056 9:30989264-30989286 CCTGCCCTCCACCTTCTGAAAGG - Intergenic
1052872640 9:33523669-33523691 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1053007420 9:34613282-34613304 CCTGCCCTGCACGGGCTAGCAGG - Intergenic
1053067383 9:35078220-35078242 TCTGCCCTGCACCGCCTGGTTGG - Exonic
1053259091 9:36646069-36646091 CCTGGCCTCCACCCGCTAGATGG - Intronic
1053752320 9:41269184-41269206 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1053752770 9:41273441-41273463 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054257847 9:62833516-62833538 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054258295 9:62837793-62837815 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054333475 9:63782248-63782270 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1054351584 9:64021294-64021316 TCTGTCCTGCAGCAGCTGCACGG + Intergenic
1055401525 9:75929559-75929581 CCTCCCCTACTGCAGCTGGAGGG - Intronic
1055739981 9:79377487-79377509 CCTGCCCTGCAGCTGGGGGAGGG - Intergenic
1056249754 9:84735447-84735469 GATGCCCTGCAGAAGCTGGAGGG + Intronic
1056660417 9:88539072-88539094 CATCCCCTGCACCAACTGGGAGG - Intronic
1057606206 9:96499376-96499398 CCTGCCCGGCACCAGAGGCAAGG + Intronic
1057825606 9:98370201-98370223 CCTGTCCAGGACTAGCTGGAGGG + Intronic
1059348629 9:113649117-113649139 CCGGCCCTGCACCAGCAGCCAGG - Intergenic
1059427462 9:114230210-114230232 CCTGCCTGGCTCCTGCTGGAAGG + Intronic
1060348820 9:122839470-122839492 ACTGCCCTGCACCACCTCGGTGG - Intergenic
1060512348 9:124243155-124243177 TCTGGCCTGCACCGGCTGGTTGG - Intergenic
1060961447 9:127683568-127683590 CCTGAGCTGCCCCAGCTGGGAGG + Intronic
1061083863 9:128387914-128387936 CCTTCCCTGAAGCAGGTGGAGGG + Intronic
1061192076 9:129087903-129087925 CCTGCCCTGCCCCGCCTGGCCGG + Intronic
1061424055 9:130488360-130488382 CCTGCCCTGCAGCTGCTGTCTGG - Intronic
1061996716 9:134189898-134189920 CCTGCTTTGCACCAGATGGAAGG - Intergenic
1062037091 9:134387162-134387184 TCTGGCCTCCACCAGCAGGATGG - Intronic
1062139832 9:134949851-134949873 CCTGCTCTGCATCAGCGTGATGG - Intergenic
1062502705 9:136858167-136858189 CCTGCCCTGCACCCGCCAGGTGG + Exonic
1062538605 9:137031720-137031742 CGTGCCCTGCAGCAGCACGAGGG + Exonic
1062562480 9:137147818-137147840 CCTGCCGTGCACCTGCTGTGTGG - Intronic
1062573711 9:137196959-137196981 CAGGCCCTGGACCAGCAGGAGGG - Intronic
1202800478 9_KI270719v1_random:170582-170604 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1202800924 9_KI270719v1_random:174864-174886 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1185870347 X:3659491-3659513 CCTGCCCCTCAGCAGCTGGGTGG + Intronic
1186817991 X:13256742-13256764 CCTGCCTAGCAACAGCTGAAGGG - Intergenic
1187131414 X:16506802-16506824 CCTGGGCTGCACTAGCTGGTGGG + Intergenic
1188180657 X:27051094-27051116 CCCGCCCTGAAGCAGCTGGTTGG + Intergenic
1190178937 X:48175088-48175110 CCTGCCCTTAACCATCTGAATGG + Intergenic
1190192418 X:48288499-48288521 CCTGCCCCCCACCATCTGAATGG - Intergenic
1192204723 X:69088374-69088396 CCTGCCCTGGGACAGCTGGCTGG + Intergenic
1194910798 X:99642019-99642041 CCTGCTCTGCAGGAGCTGGCTGG - Intergenic
1196113208 X:111969416-111969438 CCTGCCCTGAAACAGAAGGATGG - Intronic
1197022158 X:121704834-121704856 TCTGCCCTACACCAGTGGGAGGG + Intergenic
1197075760 X:122350756-122350778 CCTGCCCTGGGCCAGAGGGAGGG + Intergenic
1199593427 X:149488590-149488612 GCTGCCCTGCACCAGGCAGAGGG + Intronic
1199598590 X:149526841-149526863 GCTGCCCTGCACCAGGCAGAGGG - Intronic
1199738780 X:150711712-150711734 CCGCCCCAGCACCAGCTGCATGG - Intronic
1199738956 X:150714457-150714479 CCTGCACAGCACCAGGTGCATGG - Intronic
1199745038 X:150767146-150767168 CCGGCCCAGCACCAGCCAGAGGG + Exonic
1200086790 X:153611058-153611080 CCTGCTCTGCCCCATCTGGAGGG + Intergenic
1201797003 Y:17906649-17906671 CCTGCTTTGCAACAGCTGGCAGG + Intergenic
1201804550 Y:17999336-17999358 CCTGCTTTGCAACAGCTGGCAGG - Intergenic
1202603836 Y:26621802-26621824 CCTGCCCTACATGAGCTGGCAGG - Intergenic