ID: 1077251181

View in Genome Browser
Species Human (GRCh38)
Location 11:1561414-1561436
Sequence TGGACTCCCCGCCAGGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077251169_1077251181 -4 Left 1077251169 11:1561395-1561417 CCGCCACCTCCATGACCCCTGGA 0: 1
1: 0
2: 7
3: 38
4: 447
Right 1077251181 11:1561414-1561436 TGGACTCCCCGCCAGGGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 120
1077251170_1077251181 -7 Left 1077251170 11:1561398-1561420 CCACCTCCATGACCCCTGGACTC 0: 1
1: 0
2: 0
3: 37
4: 342
Right 1077251181 11:1561414-1561436 TGGACTCCCCGCCAGGGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 120
1077251171_1077251181 -10 Left 1077251171 11:1561401-1561423 CCTCCATGACCCCTGGACTCCCC 0: 1
1: 1
2: 4
3: 31
4: 442
Right 1077251181 11:1561414-1561436 TGGACTCCCCGCCAGGGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 120
1077251167_1077251181 -3 Left 1077251167 11:1561394-1561416 CCCGCCACCTCCATGACCCCTGG 0: 1
1: 0
2: 4
3: 53
4: 453
Right 1077251181 11:1561414-1561436 TGGACTCCCCGCCAGGGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 120
1077251166_1077251181 20 Left 1077251166 11:1561371-1561393 CCACAGTCACAGACGCACTTCTG 0: 1
1: 0
2: 1
3: 12
4: 191
Right 1077251181 11:1561414-1561436 TGGACTCCCCGCCAGGGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077251181 Original CRISPR TGGACTCCCCGCCAGGGCGG GGG Intronic
900707951 1:4092148-4092170 TGCACACCCCACCAGGGCTGTGG + Intergenic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
903069053 1:20717742-20717764 GGGAGTCCCCGGCGGGGCGGGGG - Exonic
904840387 1:33368524-33368546 TGGAGTCCTCACCTGGGCGGGGG + Exonic
907159104 1:52358432-52358454 TGGACTCCAGGCCAGGGATGGGG + Exonic
907160481 1:52365741-52365763 TGGTCTCCCCGCCAGCGCTGTGG - Intronic
915467394 1:156105493-156105515 TGAACTCCCAGCCAGGAGGGTGG - Intronic
917510177 1:175663180-175663202 TGGATCCCCCGCCAGCGTGGCGG - Intronic
922372935 1:224929641-224929663 TGGCCTCTTCGCCAGGGCGCAGG + Intronic
1065561603 10:26969520-26969542 TGGAGTCCCTGCCAAGGAGGTGG - Intergenic
1069844478 10:71361738-71361760 TGGCCTGCCTGCCAGCGCGGTGG - Intronic
1073466341 10:103696572-103696594 TGGAGTCACCGGCAGGGTGGGGG - Intronic
1076522838 10:131091559-131091581 AGGCCTCTCCACCAGGGCGGAGG - Intergenic
1077251181 11:1561414-1561436 TGGACTCCCCGCCAGGGCGGGGG + Intronic
1078222688 11:9364636-9364658 TGCAATCCCCGCCAGCTCGGCGG + Intergenic
1079306624 11:19329174-19329196 TGGACTCCTCCCAAGGGAGGAGG + Intergenic
1080643011 11:34168817-34168839 AGGATTCCCAGCCAGGGAGGCGG - Intronic
1082766525 11:57172660-57172682 TGTTCTCCCTGCCAGGGAGGTGG + Intergenic
1085284541 11:75351419-75351441 TGGTCTCCCCGGCAGGGCCGTGG - Intronic
1089537395 11:119169069-119169091 CGGCCTCCCAGCCAGGGCGCAGG - Exonic
1089946549 11:122479935-122479957 GGGACTCCCCTTCAGGGCAGTGG - Intergenic
1091558740 12:1594611-1594633 TGGTCCCCCCGCCTGGGCGGCGG - Intronic
1092211025 12:6646641-6646663 TGGACTCCACGCCATGGGGAGGG + Intronic
1094825223 12:34264412-34264434 GGGCCCCCCCGCCAGGGCAGAGG - Intergenic
1098217549 12:68236168-68236190 TGGGCTCCCCGCCTGGGGAGAGG + Intergenic
1098372095 12:69770291-69770313 TGGAATCCCCGGCAGGGTGGGGG - Intronic
1112570413 13:100588676-100588698 AGGACACCCCGCCTGGGGGGCGG + Intronic
1113040962 13:106103635-106103657 TGTACTCCCTGCAAGGGCAGGGG + Intergenic
1113503898 13:110799716-110799738 TGCAATCCCGGCCAGGGCTGAGG + Intergenic
1113785683 13:113001094-113001116 GGGACTCCCACCCAGGGCAGCGG + Intronic
1114485608 14:23059687-23059709 TGCACTCCCAGCCTGGGCGACGG - Intronic
1121145474 14:91578391-91578413 TGGATCCCACGCCAGGGCCGCGG - Intergenic
1122128138 14:99590233-99590255 GGGACTACCCTCCAGGGTGGGGG + Intronic
1122804148 14:104248171-104248193 AGGACTCCCCACCAGTGAGGAGG + Intergenic
1123931050 15:25171814-25171836 CGGACTCACCTCCAGGGTGGTGG + Intergenic
1124562028 15:30783136-30783158 TGGATCCCACGCCAGGGCTGTGG + Intergenic
1131912672 15:97224664-97224686 TGGATTCCGCGCCGGGGCCGCGG - Intergenic
1132542266 16:516054-516076 TGGCCTCCCCGGCAGTGCAGAGG + Intronic
1132970021 16:2682656-2682678 TGGACACGCTGCCAGGGCGCTGG - Exonic
1134895346 16:17881416-17881438 TGGACTCCCAGCCAGTGCTCTGG - Intergenic
1136239721 16:28936713-28936735 GGGACTCCCCGCCCCGGGGGCGG - Intronic
1136912264 16:34154098-34154120 TAGGGCCCCCGCCAGGGCGGAGG - Intergenic
1139513190 16:67438864-67438886 TGTACTCCTGGCCAGGGGGGTGG + Exonic
1141430475 16:83968393-83968415 AGGACTGCCCGCCGGGGCGAGGG - Intergenic
1141832172 16:86515921-86515943 TGGACTAGCGTCCAGGGCGGCGG + Intergenic
1141986791 16:87585447-87585469 GGGACTCCCCGCCAGTGCTGAGG - Intergenic
1142177350 16:88651226-88651248 GGAACTCCCCGCCTGGGCTGGGG - Intergenic
1142373764 16:89696625-89696647 TGGACAGCCCGCCCAGGCGGCGG - Exonic
1143181538 17:4987115-4987137 AGGACTCCGCCCCAGGGCGCAGG + Intronic
1145123290 17:20279773-20279795 TGGTCTCCCAGCCAGAGCTGTGG + Intronic
1146631688 17:34474502-34474524 TGGACTCCCAGCCAGGCCATGGG + Intergenic
1147702359 17:42404119-42404141 TGGACCCCCAGCCAGGGTGAGGG + Exonic
1148775827 17:50095319-50095341 TGGAATGCCCGCCAGGGCAAGGG + Exonic
1149994618 17:61400098-61400120 CGGACCCCCGGCCCGGGCGGCGG - Exonic
1152695218 17:81740847-81740869 TGCTCCCCCCGCCAGCGCGGCGG - Intergenic
1163493073 19:17628175-17628197 TGGACCCCCCACCAGGCCTGGGG - Intronic
1163715038 19:18868510-18868532 TGGACTCCTTGCCTGGGTGGTGG - Intergenic
1165151619 19:33763966-33763988 TGGCCACCCAGCCAGGGCTGGGG + Intronic
1166340121 19:42132414-42132436 TGCCCGCCCCGCCAGGGCTGGGG + Exonic
1166567550 19:43774441-43774463 AGGAATCCCGGCCAGGGCTGCGG + Exonic
1166881777 19:45934454-45934476 TAGATTCCCCGGCAGGGTGGTGG - Exonic
1167379513 19:49130392-49130414 TGGAATCCCCGCCAGGACCCAGG - Exonic
928279055 2:29928153-29928175 TGGACTCCCCACCTGGACTGTGG - Intergenic
928723043 2:34142477-34142499 TGGATCCCACGCCAGGGCTGTGG + Intergenic
930631161 2:53756809-53756831 TGGACACCCTGCCAGATCGGAGG - Intronic
934856319 2:97732575-97732597 TGGACACCCAGCCACGGAGGAGG - Intronic
936503283 2:113083540-113083562 TTGCCTCCCCGCCAGGGTGTAGG - Intergenic
944412828 2:199459232-199459254 CGGCCTCCCCGCCCGGGGGGAGG + Intronic
944579183 2:201117110-201117132 TGAAATTCCCTCCAGGGCGGCGG - Intronic
945869222 2:215208291-215208313 TGGATCCCACGCCAGGGCCGCGG - Intergenic
946043638 2:216803503-216803525 TGGACTCCCAGCCAGGAGGCTGG + Intergenic
948607694 2:239146614-239146636 TGGAGTGCCCGGCAGGGCTGTGG - Intronic
1169142446 20:3234053-3234075 CGGTCTCCCGGCCCGGGCGGGGG - Intronic
1171768999 20:29307139-29307161 TAGGGCCCCCGCCAGGGCGGAGG + Intergenic
1176552732 21:8236028-8236050 TAGGGCCCCCGCCAGGGCGGAGG - Intergenic
1176571630 21:8418431-8418453 TAGGGCCCCCGCCAGGGCGGAGG - Intergenic
1176579542 21:8462994-8463016 TAGGGCCCCCGCCAGGGCGGAGG - Intergenic
1179712322 21:43270417-43270439 TGGACTCCACGCCCGGCCTGGGG - Intergenic
1179947606 21:44688747-44688769 TGGACTGCCGACCAGGGCAGAGG + Intronic
1180340983 22:11618378-11618400 TAGGGCCCCCGCCAGGGCGGAGG - Intergenic
1181478250 22:23181395-23181417 GGGACCCCCCGCCAGCGTGGCGG + Exonic
1184172778 22:42769418-42769440 AGGGCTCCCAGCCAGGGAGGGGG + Intergenic
1184276397 22:43411747-43411769 CGGACTCCGAGCCCGGGCGGGGG + Intronic
1185067913 22:48641161-48641183 TGGCCCCCCTGCCAGGGCAGTGG + Intronic
1185194228 22:49458798-49458820 TGGACACCCCGCAGGGGCTGGGG - Intronic
1203257711 22_KI270733v1_random:152430-152452 TAGGGCCCCCGCCAGGGCGGAGG - Intergenic
951491158 3:23271973-23271995 TGGATCCCGCGCCAGGGCCGTGG + Intronic
952382719 3:32817410-32817432 CGGCCTCCCCTGCAGGGCGGTGG - Intergenic
954437312 3:50503116-50503138 TGCGCTCCGCGCCAGGGCAGAGG - Intronic
961449063 3:126994334-126994356 AGCACTCCCAGCCAGGTCGGAGG - Intronic
961539522 3:127590334-127590356 TGGGCTTCCCGCCGGGGCGAGGG + Intronic
968702517 4:2063637-2063659 TGGACACCAAGCCAGGGCAGTGG - Intronic
974843552 4:67324333-67324355 TTGACTCCCCAGCAGGGCTGGGG - Intergenic
978864953 4:113496165-113496187 TGCACTCCTCGCCAGGGGTGTGG - Intronic
980092626 4:128458233-128458255 TGTAATCCCAGCCAGGGCAGGGG + Intergenic
987057222 5:14205199-14205221 TGGCCTCAGCGCCAGGGAGGTGG + Intronic
992913766 5:81426349-81426371 TGTACTACCCTCCAGGGTGGTGG + Intronic
996481713 5:123982942-123982964 TGGACTCCCAATCAGGGTGGAGG - Intergenic
1003364388 6:5458359-5458381 TGGCCTTCCTGCCAGGGCTGAGG + Intronic
1008092810 6:47309598-47309620 TGGGCTCCCGGCCCGGGAGGCGG - Exonic
1012598416 6:101066612-101066634 TGGATCCCACGCCAGGGCCGTGG + Intergenic
1013156091 6:107491459-107491481 TGGGCTCCCCGCCAGGCCAGCGG + Intronic
1013174962 6:107669090-107669112 AGGACTGCCAGCCAGGGAGGTGG - Intergenic
1018955937 6:168410706-168410728 TGCACAGCCTGCCAGGGCGGGGG + Intergenic
1020064125 7:5174645-5174667 TGGGCTCCCCTCCTGGGAGGCGG - Intergenic
1020212519 7:6167019-6167041 TGGAAGCCCCGCCAGGGCTCAGG - Intronic
1021865202 7:24949572-24949594 TGAACTCCCCGCCATGGCAATGG - Intronic
1022113078 7:27243243-27243265 TGGACTCGCAGGCAGCGCGGCGG + Exonic
1029599550 7:101555772-101555794 TTTCCTCCCCGCCAGGGCGAGGG + Exonic
1032875808 7:136037135-136037157 AGGATTCCCAGCCAGGGCTGAGG - Intergenic
1034643171 7:152621041-152621063 TGGAATCTCAGCCAGGGCGGTGG + Intergenic
1034876927 7:154732971-154732993 TGGAGTCCAGGCGAGGGCGGTGG - Intronic
1036225980 8:6958004-6958026 TGGACTCCCCCTCTGGGCCGGGG + Intergenic
1049003423 8:139840220-139840242 TGGCCTCCCCTGCAGGGAGGTGG + Intronic
1051928979 9:22363413-22363435 TAGATCCCACGCCAGGGCGGGGG + Intergenic
1058049668 9:100393064-100393086 TGGCCTCCCCGTCTGGGAGGTGG + Intergenic
1060285525 9:122248393-122248415 TGTACTCCCCGCAAGGGCCCTGG + Intronic
1061396157 9:130344184-130344206 TGTACTTCCCGCCACGCCGGGGG - Intronic
1061458814 9:130719493-130719515 TGCACTCCCAGCCTGGGCGACGG + Intronic
1061962061 9:133993290-133993312 TGGGCCCCCGGCCAGGGCGGAGG - Intergenic
1062013316 9:134278362-134278384 TGGACCCCCCGCCAGGCTGCAGG - Intergenic
1062042107 9:134408883-134408905 TGGGCTCCCTGCCGGGGCGGTGG + Intronic
1203473903 Un_GL000220v1:134452-134474 TAGGGCCCCCGCCAGGGCGGAGG - Intergenic
1203362681 Un_KI270442v1:231294-231316 TAGGGCCCCCGCCAGGGCGGAGG + Intergenic
1185448104 X:269544-269566 TGCAGTCCCCGCCCAGGCGGAGG - Intergenic
1185612740 X:1402245-1402267 GGGACTCCCGGGGAGGGCGGTGG - Intergenic
1190712189 X:53079049-53079071 TGGACTCCACCCCTGGGAGGAGG - Exonic
1195427291 X:104748656-104748678 TGGAATCCCACCCAGGGCTGTGG - Intronic
1199163845 X:144647322-144647344 TGGACCCCCCGCCGGGGCCTGGG - Intergenic
1201075565 Y:10184916-10184938 TAGGGCCCCCGCCAGGGCGGAGG - Intergenic