ID: 1077251395

View in Genome Browser
Species Human (GRCh38)
Location 11:1562208-1562230
Sequence ACTCTGGCCTCGAGGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 166}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077251374_1077251395 24 Left 1077251374 11:1562161-1562183 CCCACCCACCAGTGCTGGGTGAG 0: 1
1: 0
2: 1
3: 25
4: 184
Right 1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1077251378_1077251395 20 Left 1077251378 11:1562165-1562187 CCCACCAGTGCTGGGTGAGGGCC 0: 1
1: 0
2: 2
3: 20
4: 222
Right 1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1077251382_1077251395 -2 Left 1077251382 11:1562187-1562209 CCCAGCCCCCCAAACCGTCCCAC 0: 1
1: 0
2: 1
3: 25
4: 266
Right 1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1077251379_1077251395 19 Left 1077251379 11:1562166-1562188 CCACCAGTGCTGGGTGAGGGCCC 0: 1
1: 0
2: 2
3: 39
4: 350
Right 1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1077251383_1077251395 -3 Left 1077251383 11:1562188-1562210 CCAGCCCCCCAAACCGTCCCACT 0: 1
1: 0
2: 1
3: 17
4: 237
Right 1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1077251386_1077251395 -8 Left 1077251386 11:1562193-1562215 CCCCCAAACCGTCCCACTCTGGC 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1077251387_1077251395 -9 Left 1077251387 11:1562194-1562216 CCCCAAACCGTCCCACTCTGGCC 0: 1
1: 0
2: 2
3: 8
4: 163
Right 1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1077251381_1077251395 -1 Left 1077251381 11:1562186-1562208 CCCCAGCCCCCCAAACCGTCCCA 0: 1
1: 0
2: 4
3: 39
4: 459
Right 1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1077251375_1077251395 23 Left 1077251375 11:1562162-1562184 CCACCCACCAGTGCTGGGTGAGG 0: 1
1: 1
2: 4
3: 27
4: 253
Right 1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1077251384_1077251395 -7 Left 1077251384 11:1562192-1562214 CCCCCCAAACCGTCCCACTCTGG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1077251388_1077251395 -10 Left 1077251388 11:1562195-1562217 CCCAAACCGTCCCACTCTGGCCT 0: 1
1: 0
2: 0
3: 7
4: 153
Right 1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1077251380_1077251395 16 Left 1077251380 11:1562169-1562191 CCAGTGCTGGGTGAGGGCCCCAG 0: 1
1: 0
2: 6
3: 41
4: 384
Right 1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG 0: 1
1: 0
2: 0
3: 10
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077251395 Original CRISPR ACTCTGGCCTCGAGGGAGAC AGG Intronic
900570607 1:3356415-3356437 AATCTGCCCTCCGGGGAGACGGG + Intronic
900887170 1:5423284-5423306 TCTCTGGCATGGAGAGAGACCGG + Intergenic
903543052 1:24107647-24107669 TCTCTGGCCTTGTGGGAAACTGG + Intronic
903852908 1:26318966-26318988 CTTCTGGCATAGAGGGAGACAGG - Intronic
907257651 1:53191856-53191878 AGTCTGGCCTCCAGGGACCCTGG - Intergenic
907274551 1:53310072-53310094 ACCCTGGCCTTCAGGGGGACAGG + Intronic
907615007 1:55914499-55914521 ATTCTGGCCTTCAGTGAGACAGG - Intergenic
910224156 1:84919200-84919222 ACTCTGTCCTCGAGGTTGAGTGG - Intergenic
914415036 1:147471749-147471771 AGACTGGCCTTGAGGGAAACAGG + Intergenic
915120158 1:153625392-153625414 ACTCTGGCCTCGAAGAGGCCTGG - Intronic
917730648 1:177871574-177871596 GCTTTGGTCTCGAAGGAGACAGG + Intergenic
920571640 1:207022380-207022402 ACTCTGGCTTCGGTGGAGTCAGG + Exonic
921287659 1:213623426-213623448 ACCCTGCCCTCGAGGGATGCCGG + Intergenic
1064031674 10:11886945-11886967 TCTCTAGCCTCGTGGGAGATGGG + Intergenic
1067114354 10:43423132-43423154 AGTCTGGCATCCAGGCAGACTGG + Intergenic
1067559016 10:47291615-47291637 ACTCTGACCCAGAGGGACACAGG - Intergenic
1067740113 10:48889100-48889122 ACTCTGGCCTGGAAGGTGGCTGG + Intronic
1069921080 10:71816049-71816071 ACTCTGGCCTCTAGGGAGCAGGG + Intergenic
1070846106 10:79523823-79523845 ATTCTGGGCTGGAGGGAGCCTGG + Intergenic
1070927692 10:80236487-80236509 ATTCTGGGCTGGAGGGAGCCTGG - Intergenic
1073105547 10:101030502-101030524 TCTCTGGCCTAGGGTGAGACAGG - Intronic
1073511268 10:104044042-104044064 GCTCTGGCCTCCAGGGACTCTGG - Intronic
1075147518 10:119895019-119895041 ACTGTTGCTTCCAGGGAGACAGG - Intronic
1075247520 10:120836452-120836474 TCTCTGGCCTGCAGGGAGCCTGG - Intergenic
1075515743 10:123106719-123106741 GCCCTGGCCTAGATGGAGACAGG - Intergenic
1076230126 10:128813403-128813425 ACTGTGGCCTGGAGGGAGCAGGG + Intergenic
1076777612 10:132706763-132706785 CCACTGTCCTGGAGGGAGACAGG + Intronic
1077178706 11:1202873-1202895 TCTCTGGCCCAGAGGGACACTGG - Intergenic
1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG + Intronic
1078104562 11:8350611-8350633 GCTCTGGCCTTCAGGGAGAGAGG + Intergenic
1081654169 11:44846431-44846453 GCTCTGGCCTCAGGGGAGGCAGG - Intronic
1083282920 11:61638498-61638520 ACACTGGGCACGAGGGTGACAGG - Intergenic
1083712226 11:64556421-64556443 ACTCTGACCTCCAAGGTGACGGG - Intronic
1086495498 11:87400567-87400589 ACTCTGGCCGCAAAGGACACTGG - Intergenic
1090094903 11:123733077-123733099 ACACTGGTCTGGAGGGGGACAGG - Intronic
1090606089 11:128424391-128424413 ACTGAGGCCTGGAGGCAGACAGG - Intergenic
1091773447 12:3168846-3168868 ACACTGGCCGGGAGGGAGGCGGG - Intronic
1095976385 12:47943271-47943293 ACTCTGGCCATGAGGGAGCAGGG + Intergenic
1100730498 12:97462285-97462307 ACTCTAGCCTCTAGGGAAATAGG + Intergenic
1102188847 12:110970597-110970619 ACCCTGGCAGCCAGGGAGACTGG + Intergenic
1102603417 12:114050684-114050706 ACTCTGGCCTCGCAGCTGACTGG - Intergenic
1103890996 12:124239054-124239076 ACTCTGCCCTCCAGGGAAACAGG - Intronic
1108420151 13:50240416-50240438 CCTCTGGCCTGGAGGGAGAGAGG - Intronic
1113913130 13:113854013-113854035 AGGCTGACCTGGAGGGAGACAGG + Intronic
1114196227 14:20478749-20478771 AATCTGACCAAGAGGGAGACTGG - Intergenic
1114412759 14:22516219-22516241 ACTCAGGCCTCTAGGAAGACAGG - Intergenic
1114796623 14:25722788-25722810 ACTCTGGCCTCCAGAGTAACTGG + Intergenic
1118909166 14:70046843-70046865 ACTGTGGACTCAAGGAAGACGGG + Intronic
1122623760 14:103073953-103073975 ACTGTGGCCGCCAGGGAGATAGG - Intergenic
1124627669 15:31318191-31318213 ACTCTGGACTAATGGGAGACAGG + Intergenic
1126822803 15:52521484-52521506 ATGCTGGGCTAGAGGGAGACTGG - Intronic
1127482807 15:59392562-59392584 ACTCAGGCTGGGAGGGAGACAGG + Intronic
1128080647 15:64855060-64855082 ACTCTGGGCTAGAGGGAGATGGG - Intronic
1128223929 15:65988764-65988786 TCTCTGGGCTGGAGGAAGACAGG + Intronic
1130152271 15:81320129-81320151 ACTGTGACCTCGAGAGAGCCTGG - Intronic
1132925634 16:2427993-2428015 CCTCTGCCCTAGGGGGAGACAGG + Intergenic
1132982420 16:2745294-2745316 ACACTGGCCTGGAGGGAAGCTGG + Intergenic
1135125919 16:19809181-19809203 ACTTTGCCCTGGAGGGAAACTGG - Intronic
1137850607 16:51738346-51738368 ACTGAGGCCTAGAGGGAGAAAGG - Intergenic
1140872925 16:79123240-79123262 ACTCTGTCCTCGGTGGGGACAGG + Intronic
1142186570 16:88697655-88697677 GCACCGGGCTCGAGGGAGACAGG + Intronic
1144519369 17:15944255-15944277 ACTCTCGCCAGGAGAGAGACTGG - Intergenic
1145978709 17:28998878-28998900 ACTCTGGCCTCCAGAAGGACAGG - Intronic
1145992095 17:29085431-29085453 ACTCTATCCTCGGGGGAGGCAGG - Intronic
1146970375 17:37067029-37067051 GCTCAACCCTCGAGGGAGACTGG + Intergenic
1150317107 17:64178267-64178289 ACTCTGGCCTGGAGGGGGTCAGG + Intronic
1151542419 17:74771361-74771383 CCTCTGGCCTCTAAGGAGAAAGG + Exonic
1152210059 17:78998429-78998451 ACGCTGGCCTCCAGGCAGTCAGG - Intronic
1152228128 17:79102080-79102102 ACTCTGGCCTCGGGGGAGGGGGG - Intronic
1155067462 18:22280080-22280102 ACTCTGGCCCTGAAGGGGACAGG + Intergenic
1158512173 18:58100324-58100346 ACTCTGGCCTCTAAGGGAACTGG - Intronic
1161108276 19:2455314-2455336 TCTCTGGGCTCCAAGGAGACTGG - Intronic
1165080938 19:33305631-33305653 ACTCTGGCCAAGACGGAGAGGGG + Intergenic
1167757404 19:51421421-51421443 GCTCTGGCCTCGCTGGAGAAGGG - Intergenic
1168145952 19:54420329-54420351 TCTCTGGCGTGGGGGGAGACAGG + Intronic
926194448 2:10754103-10754125 ACTCTGGTCTAGAGGGAGCGGGG - Intronic
928271515 2:29859354-29859376 AGTCTGGCTTCAAGGGAGAGCGG - Intronic
930487675 2:52027654-52027676 ACTGTGGCCTCAAAGTAGACAGG + Intergenic
933743294 2:85551875-85551897 ACTTGGCCCTCCAGGGAGACAGG + Exonic
935279738 2:101506920-101506942 ACTTTGGCCTCAAAGAAGACAGG + Intergenic
935960855 2:108424220-108424242 AGTTTGGCCTCGAGCGAGAATGG + Intergenic
936397006 2:112138743-112138765 ACACTGGCCTGGAGAGAGGCGGG - Intronic
936397014 2:112138770-112138792 ACACTGGCCTGGAGAGAGGCGGG - Intronic
936397022 2:112138797-112138819 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397066 2:112138944-112138966 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397074 2:112138971-112138993 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397089 2:112139025-112139047 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397104 2:112139079-112139101 ACACTGGCCTGGAGAGAGGCGGG - Intronic
936397128 2:112139164-112139186 ACACTGGCCTGGAGAGAGGCGGG - Intronic
936397136 2:112139191-112139213 ACACTGGCCTGGAGAGAGGCGGG - Intronic
936397148 2:112139245-112139267 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397163 2:112139299-112139321 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397185 2:112139380-112139402 ACACTGGCCTGGAGAGAGGCGGG - Intronic
936397193 2:112139407-112139429 ACACTGGCCTGGAGAGAGGCGGG - Intronic
936397213 2:112139488-112139510 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397228 2:112139542-112139564 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397250 2:112139623-112139645 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397265 2:112139677-112139699 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397294 2:112139785-112139807 ACACTGGCCTGGAGAGAGGCGGG - Intronic
936397302 2:112139812-112139834 ACACTGGCCTGGAGAGAGGCGGG - Intronic
936397317 2:112139866-112139888 ACACTGGCCTGGAGAGAGGCGGG - Intronic
936397345 2:112139969-112139991 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397360 2:112140023-112140045 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397396 2:112140158-112140180 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397404 2:112140185-112140207 ACACTGGCCTGGAGAGAGGCGGG - Intronic
947249566 2:228086668-228086690 ACTCTGGTCATGAGGTAGACTGG - Intronic
948372548 2:237498772-237498794 ACTGTGTCCTCGTGGGAGGCAGG - Intronic
1169074618 20:2752952-2752974 ACTCAGGGCTCGAGGGAAGCCGG + Intronic
1171258786 20:23712525-23712547 AGTCTGGCCTCTAGAGAAACTGG + Intergenic
1172543540 20:35741700-35741722 GCCCAGGCCTCGAAGGAGACAGG + Intronic
1172888207 20:38245998-38246020 ACTCTGGCTTCCAGGGGGATGGG - Exonic
1174188570 20:48723775-48723797 ACTCTGGCCCCTGGGGAGATGGG + Intronic
1174317408 20:49713520-49713542 GCTCTGGCCTTGAGGGACCCGGG - Intronic
1174675632 20:52351476-52351498 GCTCTGGCATCAAGGGAGAAAGG - Intergenic
1175642323 20:60641219-60641241 AACCAGGCCTGGAGGGAGACAGG + Intergenic
1175924839 20:62466551-62466573 ACTGTGGGGGCGAGGGAGACTGG + Exonic
1181469759 22:23130871-23130893 CCTCTGGCCTCCAGAGAGCCCGG - Intronic
1183507904 22:38219712-38219734 ACTTTGGCCTGGAGGGAGAAGGG + Exonic
1183930338 22:41232467-41232489 ACACGGGCATCAAGGGAGACTGG + Intronic
1184656814 22:45946054-45946076 ACTCTGGGCTCTAGGGGGATGGG + Intronic
1184766551 22:46575572-46575594 TCTCTGTCCTCCAGGGAAACAGG - Intergenic
1185380469 22:50505431-50505453 ACTTTGGCCTGGAGGTTGACTGG - Exonic
1185413305 22:50697212-50697234 ACCCAGGCCTAGAGGGGGACTGG + Intergenic
949823067 3:8136752-8136774 ACTCTGGCCTCTAGGTTTACAGG + Intergenic
953391817 3:42538332-42538354 ACTCTGGCCTCTGAGGATACTGG - Intergenic
953799775 3:46013556-46013578 ACTCTGGCCTCAAGGGAGCTGGG - Intergenic
954932830 3:54298773-54298795 ACTCTGGCCTAGAAGGAAAGTGG + Intronic
956576880 3:70761446-70761468 ACTCTGGCCTCCAGGAAACCAGG - Intergenic
961305599 3:125958020-125958042 ATTCTGGCCTAGCGGGAGGCGGG - Intergenic
970356363 4:15257324-15257346 ACTCTGGCCAAGAGGGACAGGGG - Intergenic
973870533 4:55161450-55161472 ACTCTGACCTTGAGGCAGGCGGG + Intergenic
973971465 4:56217757-56217779 ATTCAGGCCTCGAGGGAAAGTGG - Intronic
978447054 4:108789651-108789673 ACCTTGGCCTTGAGGGAAACTGG - Intergenic
979228072 4:118313211-118313233 ACCCTGGCGGCGAGGGACACAGG - Exonic
991961564 5:72049654-72049676 ACTCTGGCTGCAAGGGAGATTGG + Intergenic
992067317 5:73120216-73120238 CCTCAGGCCTCGAGGGGGAGCGG + Intergenic
992351693 5:75936154-75936176 AATCTGGCCTCAAGGGAGTAGGG + Intergenic
995627416 5:114094237-114094259 AATCTGGCCTTGAGGGAGCAGGG - Intergenic
999675070 5:153991352-153991374 ACTTTGCCCTCAAGGGATACAGG + Exonic
1001411877 5:171518046-171518068 ACCCTGGCTCCAAGGGAGACTGG + Intergenic
1002577465 5:180182825-180182847 ACTATCACCTGGAGGGAGACTGG + Intronic
1004333794 6:14745420-14745442 ACTCAGACCTCAAGGGAAACAGG - Intergenic
1005989711 6:30895452-30895474 GCCCGGGCCTCGAGGGGGACGGG - Exonic
1006895130 6:37463290-37463312 ACTCCTGCCTCCAGGGACACAGG - Intronic
1007578282 6:42939768-42939790 AGGCTGGCCTCTAGGGAGAAGGG + Intergenic
1015180868 6:130360936-130360958 ACTCTGACCTCCAGTGAGCCGGG - Intronic
1022533179 7:31079610-31079632 ACTCTGTCCTGGAGGGGGAGGGG + Intronic
1023141709 7:37108806-37108828 ACTCTGGCCTCTGGTGAGGCTGG + Intronic
1023825491 7:44006067-44006089 ACCCTGGCCTCGATAGAGAAAGG - Intronic
1023967752 7:44971839-44971861 AATCAAGCCTCAAGGGAGACAGG - Intronic
1025035100 7:55588947-55588969 ACTCTGGGCTGGAAGGAGGCAGG - Intergenic
1026089042 7:67284840-67284862 ACCCTGGCCTCGATAGAGAAAGG - Intergenic
1026725212 7:72865510-72865532 ACCCTGGCCTCGATAGAGAAAGG + Intergenic
1027118632 7:75500166-75500188 ACCCTGGCCTCGATAGAGAAAGG - Intergenic
1027273167 7:76535302-76535324 ACCCTGGCCTCGATAGAGAAAGG + Intergenic
1027326611 7:77054373-77054395 ACCCTGGCCTCGATAGAGAAAGG + Intergenic
1029718858 7:102349855-102349877 ACCCTGGCCTCGATAGAGAAAGG + Intergenic
1029753757 7:102559402-102559424 ACCCTGGCCTCGATAGAGAAAGG - Intronic
1029771705 7:102658489-102658511 ACCCTGGCCTCGATAGAGAAAGG - Intronic
1032886068 7:136139848-136139870 ACACTGGCTTCAAAGGAGACAGG + Intergenic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1038260056 8:25985022-25985044 ACTCTGCTCTTAAGGGAGACAGG + Intronic
1038486629 8:27939974-27939996 ACTGTGGCCAGGAGGCAGACTGG - Intronic
1041555289 8:59147010-59147032 ACTCTTGCCTCCTGGCAGACAGG - Intergenic
1048976072 8:139673867-139673889 AATCTGGCCTTGGGGGAGCCAGG - Intronic
1049600938 8:143507228-143507250 ACTCTGACCTCGATGCAGGCTGG - Intronic
1051605615 9:18915281-18915303 ACTCTGGGCTCCAAGGACACAGG + Intergenic
1051685398 9:19653137-19653159 CCTCTGTCCTCAAGGGAAACAGG - Intronic
1051707828 9:19899202-19899224 GCTCTTGCCGCAAGGGAGACTGG + Intergenic
1059427048 9:114227842-114227864 AAGCTGGCCTCGAGGGCGTCTGG + Intronic
1060875427 9:127079999-127080021 ACACTGGCCTCTAGGGCAACAGG + Intronic
1185855987 X:3535779-3535801 ATTCTGACCTCCAGGGTGACTGG - Intergenic
1187403883 X:18984873-18984895 TCTCCGGCCTCGAGTGGGACTGG - Intergenic
1187817561 X:23249289-23249311 ACTATAGCATCCAGGGAGACAGG - Intergenic
1192589839 X:72350826-72350848 ATTCTGGCCTCGGGGTAGAGGGG - Intronic
1193698504 X:84737951-84737973 GCCCTGGCCTGGAGGGAGTCGGG - Intergenic
1198138025 X:133773863-133773885 TCTCTGGCCTTCAGGGAGACAGG + Intronic