ID: 1077251541

View in Genome Browser
Species Human (GRCh38)
Location 11:1563016-1563038
Sequence TTCCACTGGATGCAGGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 179}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077251535_1077251541 2 Left 1077251535 11:1562991-1563013 CCTCAGGCTGGGTGAAGGTCCCT 0: 1
1: 0
2: 1
3: 22
4: 227
Right 1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG 0: 1
1: 0
2: 1
3: 22
4: 179
1077251524_1077251541 23 Left 1077251524 11:1562970-1562992 CCCTTCATCCCCCACAGTCGCCC 0: 1
1: 0
2: 2
3: 18
4: 244
Right 1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG 0: 1
1: 0
2: 1
3: 22
4: 179
1077251523_1077251541 24 Left 1077251523 11:1562969-1562991 CCCCTTCATCCCCCACAGTCGCC 0: 1
1: 0
2: 4
3: 26
4: 365
Right 1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG 0: 1
1: 0
2: 1
3: 22
4: 179
1077251525_1077251541 22 Left 1077251525 11:1562971-1562993 CCTTCATCCCCCACAGTCGCCCT 0: 1
1: 0
2: 1
3: 22
4: 292
Right 1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG 0: 1
1: 0
2: 1
3: 22
4: 179
1077251532_1077251541 12 Left 1077251532 11:1562981-1563003 CCACAGTCGCCCTCAGGCTGGGT 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG 0: 1
1: 0
2: 1
3: 22
4: 179
1077251534_1077251541 3 Left 1077251534 11:1562990-1563012 CCCTCAGGCTGGGTGAAGGTCCC 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG 0: 1
1: 0
2: 1
3: 22
4: 179
1077251528_1077251541 14 Left 1077251528 11:1562979-1563001 CCCCACAGTCGCCCTCAGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 181
Right 1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG 0: 1
1: 0
2: 1
3: 22
4: 179
1077251522_1077251541 27 Left 1077251522 11:1562966-1562988 CCACCCCTTCATCCCCCACAGTC 0: 1
1: 0
2: 9
3: 75
4: 696
Right 1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG 0: 1
1: 0
2: 1
3: 22
4: 179
1077251527_1077251541 15 Left 1077251527 11:1562978-1563000 CCCCCACAGTCGCCCTCAGGCTG 0: 1
1: 0
2: 1
3: 15
4: 204
Right 1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG 0: 1
1: 0
2: 1
3: 22
4: 179
1077251530_1077251541 13 Left 1077251530 11:1562980-1563002 CCCACAGTCGCCCTCAGGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 141
Right 1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG 0: 1
1: 0
2: 1
3: 22
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077251541 Original CRISPR TTCCACTGGATGCAGGGCCA AGG Intronic
900324478 1:2101586-2101608 TGCCACTGGCTGCAGGGCCCGGG + Intronic
901185126 1:7368021-7368043 TTTCACTGGGTGCAGGCCCTGGG + Intronic
901892000 1:12274790-12274812 TTCCAGTGGATGCTGGGCCGTGG + Intronic
902007275 1:13242474-13242496 TTGCGCTGGCTGCAGGGCAATGG + Intergenic
902220417 1:14961006-14961028 TTCCACTCGAAGAAGGGACAGGG - Intronic
902266602 1:15271379-15271401 TTCCCCTGGTTGCAGGGCCCTGG - Intronic
903045492 1:20561534-20561556 TTCCAGTGGTGGCAGGGGCAGGG - Intergenic
903775950 1:25793938-25793960 TTGAACTGGGTCCAGGGCCAAGG - Intergenic
905059424 1:35126745-35126767 GTCCACTGGTTCCAGGGCCTGGG + Intergenic
905585607 1:39115188-39115210 TTCCTCTGGCAGCAGTGCCAAGG + Intronic
906713555 1:47950932-47950954 CTCTACTGGAAGCAGGCCCAAGG - Intronic
906720352 1:47999471-47999493 TTCCACTGGAGGGAGGGTCATGG + Intergenic
911107236 1:94143481-94143503 TTCCACTGGAGTAAGTGCCAGGG + Intergenic
911551135 1:99282380-99282402 TTCTAGTGGATGCATGGCAATGG - Intronic
912950874 1:114119318-114119340 ACCTACTGGATGCAAGGCCAGGG + Intronic
912962449 1:114208192-114208214 TGCCACTGGCTGCAGGCTCATGG + Intergenic
919938963 1:202273404-202273426 ACCCACTGGATGTGGGGCCAGGG - Intronic
920366252 1:205449820-205449842 TCCCAAGGGATGCTGGGCCAGGG + Intronic
921860974 1:220041891-220041913 TTCCACTGGAAACAGGGCTGTGG + Intronic
922324999 1:224520018-224520040 TTCAACTGGATACAGAGCCTTGG - Intronic
923168763 1:231393648-231393670 TACCACTGGAAACAGGGACATGG - Intronic
1063064778 10:2596704-2596726 TTCTCATGGATGCAGGGCAAGGG - Intergenic
1063213438 10:3902469-3902491 TTCCAGGGGATGCAGGCTCAGGG + Intergenic
1063339745 10:5252237-5252259 TCCCAGAGGATGCAGGGCCAGGG + Intergenic
1066241157 10:33536505-33536527 TTTCACTGGATGTAGAGCCCAGG - Intergenic
1068574063 10:58663727-58663749 TTTCACCGAATGCAGGGGCAGGG - Intronic
1069817991 10:71210668-71210690 ATCCCCTGGATGCAGGCACATGG - Intergenic
1073265996 10:102228750-102228772 CTGCACTGGATGTAGGGACACGG - Intronic
1076173418 10:128342329-128342351 TTACACAGAATGGAGGGCCATGG - Intergenic
1077196527 11:1283757-1283779 ATCAACTGGATACAGCGCCAGGG - Intronic
1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG + Intronic
1077488279 11:2849066-2849088 TTCCCCTGGAAGCAGTGCCCAGG + Exonic
1079188100 11:18255032-18255054 TTTCAATGGGTGCAGGGGCATGG - Intergenic
1080614592 11:33935042-33935064 TTCCTCTAGATTGAGGGCCACGG - Intergenic
1083478507 11:62928790-62928812 GTCCCCTGAATGCAGGGCAAGGG - Intergenic
1084703781 11:70804224-70804246 ATCCACTGCCTGCAGAGCCAAGG - Intronic
1086654206 11:89330563-89330585 TTCCAATTGATGCTGGTCCAAGG + Intronic
1089043700 11:115480399-115480421 TTCAAGTGGATCCAAGGCCAGGG - Intronic
1089403245 11:118177095-118177117 TCCCTCTGGAGGCAGGGCCCAGG - Intergenic
1090443513 11:126744165-126744187 TTCCAATGGCTGAAGGGCCTTGG + Intronic
1091434652 12:462892-462914 TTCCTCTGGAGGGAGAGCCAGGG + Intronic
1095463325 12:42464548-42464570 TTCTACTGCTTGCAGGGCCTGGG + Exonic
1096465496 12:51846159-51846181 GCCCACTGGGGGCAGGGCCAGGG + Intergenic
1098945887 12:76589142-76589164 TTGCACTGGCTGCATGGCCAGGG - Intergenic
1100052842 12:90471266-90471288 TTACACTGGCTCCAGGGGCAGGG + Intergenic
1101042198 12:100767958-100767980 TTCCACTAGATCCAGGGTCCAGG - Intronic
1101865902 12:108519126-108519148 CTCCACTGGGTGCAGGTTCATGG - Exonic
1101992830 12:109501315-109501337 TTCCATCTGATGCAGGGCCAGGG - Intronic
1102856650 12:116300008-116300030 ATCCCCAGGAGGCAGGGCCACGG + Intergenic
1103200308 12:119082686-119082708 TTCCCCTGGCTGGAGGCCCAGGG - Intronic
1104775874 12:131389831-131389853 TTCCATGGGAAGCAGAGCCAGGG - Intergenic
1106099826 13:26684495-26684517 TTCCACTGGATTCTGAACCAGGG + Intronic
1109589418 13:64458806-64458828 TTCCCATGGATGTAGGGCCATGG - Intergenic
1110721690 13:78769042-78769064 TTCCAGTGGAGGTAGGGGCAAGG - Intergenic
1112129728 13:96508987-96509009 TTGCCCTGGATGCAGGGAGAAGG - Intronic
1112210592 13:97373549-97373571 TTCCACTGTATGCATGGCTAAGG + Intronic
1112423705 13:99276959-99276981 TCCCAAAGGTTGCAGGGCCAGGG - Intronic
1112487915 13:99836281-99836303 CTCCCCTGTATGCAGGGCCAGGG - Intronic
1115289427 14:31753233-31753255 CTCCACTGGTCACAGGGCCATGG + Intronic
1115567625 14:34638354-34638376 TTGCCCAGGATGGAGGGCCATGG + Intergenic
1115780603 14:36764324-36764346 TTCTACTGGGGGCTGGGCCAGGG - Intronic
1121336220 14:93078976-93078998 TTCCACTGGGCTCTGGGCCAGGG + Intronic
1121780241 14:96617602-96617624 TTCCACTGGATCCAGGGGTCAGG + Intergenic
1122152231 14:99731418-99731440 TTTCTCTGAATCCAGGGCCAGGG + Intergenic
1122200715 14:100120993-100121015 TTCCACAGGAGTCAGGGCGATGG - Intronic
1122596742 14:102899061-102899083 TTCCCCTGAGTGCAGGGACACGG + Intronic
1122792786 14:104191392-104191414 TTCCCCTGAATGCAGGTGCAAGG - Intergenic
1123938674 15:25206221-25206243 TCCCACTGGATGCATGCACAGGG + Intergenic
1124373759 15:29117598-29117620 TGCCACTGACTGCAGGGACACGG + Exonic
1124992763 15:34692232-34692254 TTCCAGTGGATGAAGCGCCTGGG - Intergenic
1125609136 15:40959040-40959062 GTCCACTGGATGAAATGCCAGGG + Intergenic
1128343205 15:66836997-66837019 TTCCCCTGTATGGGGGGCCAGGG + Intergenic
1129324743 15:74794120-74794142 GTCCACAGGAGGCAGGGGCAAGG + Intronic
1129324760 15:74794175-74794197 GTCCACAGGAGGCAGGGGCAAGG + Intronic
1129324779 15:74794230-74794252 GTCCACAGGAGGCAGGGGCAAGG + Intronic
1129324821 15:74794340-74794362 GTCCACAGGAGGCAGGGGCAAGG + Intronic
1129324840 15:74794395-74794417 GTCCACAGGAGGCAGGGGCAAGG + Intronic
1130179468 15:81610485-81610507 ATGCCCTGGATGCAGGGACATGG + Intergenic
1134002451 16:10793378-10793400 TGCCTCTGGATGCTGGGCCCAGG + Intronic
1137035896 16:35569679-35569701 TCCCACTTGGTGCAGGGCCCAGG + Intergenic
1137366411 16:47863463-47863485 TTCCTCAGGATTCAGGGCAAGGG - Intergenic
1139430759 16:66910053-66910075 CTCCACCCAATGCAGGGCCAAGG + Exonic
1141703517 16:85652973-85652995 TTCCCAGGGATGCAGAGCCACGG - Intronic
1142867936 17:2802229-2802251 ATCCCCTGGATGCAGGTCCCTGG + Intronic
1143262442 17:5609779-5609801 TTCCACTGGGTGGAGGGAGAGGG - Intronic
1143358370 17:6347851-6347873 GTGCACTGGATGAAGGGCCCAGG + Intergenic
1143381907 17:6501831-6501853 TTCCACACCATGCAAGGCCACGG - Intronic
1143432009 17:6894471-6894493 TACCGCTGGGTGCAGGGCCACGG + Intronic
1147143877 17:38474383-38474405 TTCCAGGGGAAGGAGGGCCAGGG + Intronic
1150134511 17:62688634-62688656 TGCCACTGGGAGCAGGGCTAGGG - Exonic
1151294334 17:73173238-73173260 TTTCTCTGGTTGCAGGGTCATGG - Intergenic
1152244795 17:79179723-79179745 GTCCACTGGATCCCAGGCCAGGG + Intronic
1152656781 17:81523563-81523585 CTCACCTGGCTGCAGGGCCAAGG + Intronic
1152862879 17:82705923-82705945 CTCCACTGCATGCTGGGCTACGG - Intergenic
1155304390 18:24464815-24464837 TTCTACTGGGAGCAGGGGCATGG + Intronic
1155382894 18:25244158-25244180 CTCCACCAGATGCAGGTCCAGGG + Intronic
1157911007 18:51617290-51617312 TTCCACTGGATGTAGGCCCTCGG - Intergenic
1166177140 19:41082125-41082147 TTACCCTGGTTGCAGGCCCAAGG - Intergenic
1166846883 19:45733793-45733815 ATGCTCTGGGTGCAGGGCCACGG + Intronic
1168459093 19:56538892-56538914 GCCCAGTGGATGCCGGGCCATGG + Intergenic
1168713107 19:58512891-58512913 CTCCGCTGGATGCAGGGGCCTGG + Intergenic
925993055 2:9269318-9269340 TTCCAATGAATGCAAGGACAGGG - Intronic
927679134 2:25128632-25128654 TCTCCCTGGAAGCAGGGCCAAGG + Intronic
928370390 2:30736204-30736226 TTGCAGTGGATGCAGGGGCGGGG + Intronic
930202652 2:48559875-48559897 TACCATTGGATGCTGGGCCTTGG - Intronic
930540248 2:52697183-52697205 TTCCAGTGGATCTAGTGCCATGG + Intergenic
931041763 2:58308819-58308841 ATTCAGTGGATGCAAGGCCAGGG + Intergenic
932712844 2:74080632-74080654 TTCCCCTTGCTGCATGGCCACGG + Intronic
933950641 2:87326560-87326582 TCCCACAGAATGCAGGGACAGGG - Intergenic
936329137 2:111532019-111532041 TCCCACAGAATGCAGGGACAGGG + Intergenic
936572840 2:113630744-113630766 TTCCACAGGAGGCAGTGCCCAGG - Intronic
937451972 2:122009602-122009624 TTCCCATGGATGCAGGGCCTGGG + Intergenic
937789754 2:125945699-125945721 TCCCCCAGGGTGCAGGGCCAGGG - Intergenic
938494430 2:131785882-131785904 TTCCACTTGGACCAGGGCCAGGG - Intergenic
938556373 2:132428411-132428433 TACCACTTGATGCAGGGTCTGGG + Intronic
940914503 2:159239589-159239611 TTCCACTGGCTTCTGTGCCAAGG + Intronic
942640796 2:178058946-178058968 ATGCACTGGATGCAGGCTCATGG - Intronic
943081324 2:183261660-183261682 TTCCACAGGATGCAGTGGCTTGG - Intergenic
946054298 2:216887454-216887476 GTCCACAGGGAGCAGGGCCAGGG - Intergenic
948783806 2:240340584-240340606 TACCCCAGGAGGCAGGGCCAGGG + Intergenic
1169421770 20:5466284-5466306 TTCCACTGGTTTCAGTGACAAGG + Intergenic
1169477113 20:5941684-5941706 TCCCACTGGATGCAGGGGATGGG - Intronic
1171187536 20:23133438-23133460 TCCCAGTGGATGCAGGGTCGGGG + Intergenic
1171488517 20:25500546-25500568 TTCCCCTGAATGTTGGGCCAAGG - Intronic
1173245891 20:41337268-41337290 TCCCACTGCATGCAGGACTAAGG - Intergenic
1173945419 20:46946384-46946406 CTCCCCAGGGTGCAGGGCCAAGG + Intronic
1174512400 20:51063763-51063785 TTCTTCTGGATGGAGAGCCAGGG + Intergenic
1175104588 20:56605574-56605596 TTCCACTGGATCTGGGGCCCTGG - Intergenic
1175204342 20:57300425-57300447 TGGCCCTGGATGCAGGGCCATGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176613507 21:9008495-9008517 TTCCACTTGGTCCAGGGCCAGGG + Intergenic
1176711686 21:10155388-10155410 TTCCACTTGGACCAGGGCCAGGG - Intergenic
1177653129 21:23983373-23983395 TTGCACTGGATGTAGGTCCATGG - Intergenic
1181603187 22:23964384-23964406 TTCTACTGGAGGCAGGTCCTTGG - Intergenic
1181605327 22:23976923-23976945 TTCTACTGGAGGCAGGTCCTTGG + Intronic
1185128747 22:49025770-49025792 GGCCACTGGAGGCAGGGCCATGG + Intergenic
1185427351 22:50780116-50780138 TTCCACAGGAGGCAGTGCCCAGG + Intronic
949643122 3:6062693-6062715 TGCCACAGCATGCAGAGCCATGG + Intergenic
953240070 3:41140863-41140885 TGCCAATGGAAGCAGGGGCAGGG + Intergenic
961450973 3:127002167-127002189 CTGCACTGGCTGCAGGGCCATGG - Intronic
961774601 3:129275342-129275364 TGCCACTGGATCCTGGGCTAAGG + Intronic
961954463 3:130787323-130787345 TTCCCCTGGATGCAGGGTTATGG - Intergenic
963905905 3:150773507-150773529 TTCCAATGGATGAAGGGAAAGGG - Intergenic
964093255 3:152900710-152900732 TGCCACTGGATGGAGGGCCAAGG - Intergenic
966723786 3:183090284-183090306 CTCCACTGGATTTAGGGACATGG + Intronic
968711129 4:2118653-2118675 TGGCACTGGCTTCAGGGCCAGGG - Intronic
969261363 4:6036177-6036199 TGCCAGTGGAGGCAGAGCCAGGG + Intronic
971364073 4:25962469-25962491 TTCCACTGGATGGAGGGAGGAGG + Intergenic
974656590 4:64831629-64831651 TTCCACTGGCAGCAGTGCCCTGG + Intergenic
975158355 4:71096797-71096819 GTCCACTGGATTTAGGGACAAGG + Intergenic
978975125 4:114859691-114859713 CTCCAGTGGATGCAGGGGTACGG + Intronic
980567481 4:134562978-134563000 TTCCACTGGGTGCAGGCTTAAGG - Intergenic
985670181 5:1202923-1202945 TTCCACTGGAGGCAGGTCGGGGG + Intronic
985927015 5:3026752-3026774 TCCCACTCTATGCATGGCCAGGG + Intergenic
986330821 5:6714647-6714669 TTCCACGGGGTGCCGGGCCGCGG - Exonic
987100888 5:14590323-14590345 ATCCACTGGAGCCAGGGCCAGGG + Intronic
989399144 5:40990488-40990510 TTCCACTGGAAGCAGAGTAAAGG + Intergenic
991354121 5:65749851-65749873 TTCCATAGGGAGCAGGGCCAAGG - Intronic
992104394 5:73437577-73437599 TTCCCGTGGATGGAGGGCCCCGG + Intergenic
1002312584 5:178323616-178323638 TTGCACTGGATGCAGGACCTGGG - Intronic
1007547352 6:42704516-42704538 TGATACTGGATGCAGGGCCGTGG + Exonic
1007815930 6:44525557-44525579 TTCCAGTGGAAGCCAGGCCAGGG - Intergenic
1008532447 6:52476110-52476132 TACCACTGGTTGCAGAGCCCTGG - Intronic
1010122276 6:72390389-72390411 TACCACTGGATGCTATGCCATGG - Intronic
1012490727 6:99780178-99780200 TCCCACTGGAAGCAGAGGCAGGG + Intergenic
1013639592 6:112060129-112060151 GACCACAGGATGCAGGGCCATGG + Intronic
1016388759 6:143554159-143554181 ATCCACAGTATGCAGGGCTATGG + Intronic
1018170450 6:161139679-161139701 TTCCCTTGGAAGCAGGGCCTCGG - Intronic
1019449638 7:1090590-1090612 CTCCACTGGCGGCAGAGCCAGGG + Intronic
1019917737 7:4144318-4144340 GTCCACTGGAGGCAGGGCAGCGG + Intronic
1022510627 7:30932966-30932988 TTCCACTGGCTGCAGTGGCTCGG - Intergenic
1022785087 7:33630766-33630788 CTCCTCTGGATGCAGAGGCATGG + Intergenic
1023141458 7:37106424-37106446 CTCCAGAGGATGCAGCGCCAAGG + Intronic
1026840764 7:73668854-73668876 TTCCACTGGAGGCAGAGGAAGGG + Intronic
1027232223 7:76279511-76279533 TGCTACTAGATGGAGGGCCAAGG + Intronic
1030807650 7:113936971-113936993 TTCCACTGGCAGCAGTGGCAAGG + Intronic
1032485836 7:132286846-132286868 TTCCAGGGGATGGAGGGCCCAGG - Intronic
1032741372 7:134742754-134742776 TTCCAGTGGAGACAGGGCAAAGG - Intergenic
1034528449 7:151680819-151680841 TCCCACTAGAATCAGGGCCATGG + Intronic
1035073729 7:156163457-156163479 TACCTCTGGACGCAGGGCTAGGG + Intergenic
1035183532 7:157108255-157108277 TTGCACTGGATGGAGGGGCCCGG + Intergenic
1035362268 7:158321426-158321448 GTCGACAGGCTGCAGGGCCATGG - Intronic
1037750470 8:21678941-21678963 TTCTGCTGGATGCAGGGCGGGGG - Intergenic
1039518032 8:38149236-38149258 TGCCCCTGGATTCTGGGCCAGGG + Intronic
1042838701 8:73101908-73101930 TCACAGAGGATGCAGGGCCACGG + Intronic
1047965929 8:130046762-130046784 GTGAACTGGATGCAGGGCCTGGG - Intergenic
1047971067 8:130085118-130085140 TGCCAAAGGATGGAGGGCCAGGG + Intronic
1051360055 9:16274100-16274122 TTCCTGTGGTTGCAGGCCCAAGG - Intronic
1052234728 9:26196737-26196759 TGCCACTGGATGTAGGCCCTGGG + Intergenic
1053648677 9:40141079-40141101 TTCCACTTGGACCAGGGCCAGGG - Intergenic
1053757069 9:41322763-41322785 TTCCACTTGGACCAGGGCCAGGG + Intergenic
1054329659 9:63739020-63739042 TTCCACTTGGACCAGGGCCAGGG - Intergenic
1058899671 9:109431091-109431113 TTACACTGGAGGCAGGGGCCAGG + Intronic
1059502841 9:114770164-114770186 TTCCACCAGCTGCAGGACCATGG - Intergenic
1060247175 9:121956893-121956915 ATCCACTGGATGCAGAACCTTGG - Intronic
1060776797 9:126380577-126380599 TTCTACTGGAGGCTGGGGCAGGG - Intronic
1061505425 9:131029170-131029192 CTCCCCTGGATCCAGGGCAAAGG + Intronic
1061947638 9:133917705-133917727 TTCAACTGGATGCCCGGCCTGGG - Intronic
1202796441 9_KI270719v1_random:124377-124399 TTCCACTTGGACCAGGGCCAGGG - Intergenic
1188162614 X:26821558-26821580 AGGCACTGGATGCAGGGGCAGGG + Intergenic
1190245181 X:48686102-48686124 TCCACCTGGATGCAGGGGCAGGG - Exonic
1197645825 X:129015530-129015552 CTCCACTGAATGCAGGGCTTGGG + Intergenic
1198434462 X:136602642-136602664 TTGCACTGGAAGCAGAGTCATGG + Intergenic