ID: 1077252297

View in Genome Browser
Species Human (GRCh38)
Location 11:1566049-1566071
Sequence CAGAGGGAGAAGGGTTCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077252297_1077252311 28 Left 1077252297 11:1566049-1566071 CCGTGGGAACCCTTCTCCCTCTG 0: 1
1: 0
2: 1
3: 25
4: 337
Right 1077252311 11:1566100-1566122 GCTCTCAGCAGGATGCAACAAGG 0: 1
1: 0
2: 0
3: 14
4: 163
1077252297_1077252309 17 Left 1077252297 11:1566049-1566071 CCGTGGGAACCCTTCTCCCTCTG 0: 1
1: 0
2: 1
3: 25
4: 337
Right 1077252309 11:1566089-1566111 TCACAAGGCCAGCTCTCAGCAGG 0: 1
1: 1
2: 3
3: 22
4: 220
1077252297_1077252303 -6 Left 1077252297 11:1566049-1566071 CCGTGGGAACCCTTCTCCCTCTG 0: 1
1: 0
2: 1
3: 25
4: 337
Right 1077252303 11:1566066-1566088 CCTCTGGAGAGACCCCGTCCAGG 0: 1
1: 0
2: 3
3: 13
4: 130
1077252297_1077252304 2 Left 1077252297 11:1566049-1566071 CCGTGGGAACCCTTCTCCCTCTG 0: 1
1: 0
2: 1
3: 25
4: 337
Right 1077252304 11:1566074-1566096 GAGACCCCGTCCAGGTCACAAGG 0: 1
1: 0
2: 0
3: 4
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077252297 Original CRISPR CAGAGGGAGAAGGGTTCCCA CGG (reversed) Intronic
900520070 1:3101109-3101131 CACAGCGAGGAGGCTTCCCACGG - Intronic
900578374 1:3395354-3395376 CAGAAAGGGAAGGGCTCCCAGGG - Intronic
900793013 1:4691931-4691953 CAGAGGGACAAGGGTCTCCAGGG + Intronic
901304628 1:8223726-8223748 CAGAGGGGGACAGCTTCCCAGGG - Intergenic
901655319 1:10765991-10766013 CAGAGGGAGACGGATATCCATGG + Intronic
903218949 1:21858268-21858290 CAGAGGGAAAAGGGCTTTCAGGG - Intronic
903387363 1:22936317-22936339 CAGAGGGACAAAGGTTCCTCGGG - Intergenic
903780628 1:25817985-25818007 CAGCAGGAGAAGGGCTCGCATGG - Exonic
903865269 1:26393057-26393079 CAGAGGGAGTGGTGTTGCCATGG + Intergenic
904585726 1:31579582-31579604 CAGAGGGAGAAGGGGGCGCCAGG + Intronic
904697460 1:32338242-32338264 CAGAGGGAGCCTGGTCCCCAGGG + Intergenic
904788255 1:32998604-32998626 CATAGCGAGAAGGATGCCCAAGG - Intergenic
905585232 1:39112001-39112023 CACAGGGGGAAGGGTTGCTAAGG - Intronic
905968376 1:42118546-42118568 CAGAGGAAAAAGTGTACCCAGGG + Intergenic
906169486 1:43712287-43712309 TACAGGTAGAAGGGTTCCCCTGG + Intronic
906703906 1:47880697-47880719 CAGAGGAAGCAGGCCTCCCATGG - Intronic
907405659 1:54252000-54252022 CAGTGGGAGAAGGTTACCCCGGG + Intronic
908443604 1:64179704-64179726 GAAAGGAAAAAGGGTTCCCATGG + Exonic
911412623 1:97529131-97529153 CAGTGGGAGAAGAGTTTACAAGG - Intronic
913320691 1:117586557-117586579 AAGAAGGAGAAGGGTCTCCAAGG + Intergenic
913652326 1:120929325-120929347 GAGAGTGAGATGAGTTCCCATGG + Intergenic
914168784 1:145199746-145199768 GAGAGTGAGATGAGTTCCCATGG - Intergenic
914523905 1:148443705-148443727 GAGAGTGAGATGAGTTCCCATGG - Intergenic
914599770 1:149192164-149192186 GAGAGTGAGATGAGTTCCCATGG + Intergenic
914642500 1:149623435-149623457 GAGAGTGAGATGAGTTCCCATGG + Intergenic
916216116 1:162396676-162396698 TGGAGGGAGAAGGGTGCACATGG + Exonic
916392139 1:164342403-164342425 CAGTGGGAGGAGGGTTCACTTGG - Intergenic
918174204 1:182029376-182029398 CAGAGGCGGGAGGGTGCCCAGGG - Intergenic
920499235 1:206476067-206476089 CAGAGAGACAGGAGTTCCCATGG - Intronic
921138876 1:212286207-212286229 CAGAGGCAGAAGCGCTCCCAGGG + Exonic
921266114 1:213421859-213421881 CAGAGGGAGACGGGGACCCAGGG - Intergenic
921279917 1:213556484-213556506 CAGAGGGAGCAGGCTTACCTAGG + Intergenic
922094430 1:222430859-222430881 CAGAGGGAGAGGGATGCCCGTGG + Intergenic
922605606 1:226888184-226888206 CACATGGAGAGGGGCTCCCAGGG - Intronic
924305643 1:242686036-242686058 CAGAGGTAGAGGAGTTCCCCTGG + Intergenic
1062975953 10:1682832-1682854 CAGGGGCAGATGGGTTCTCATGG + Intronic
1063273173 10:4534905-4534927 CGGAGGGAGAAGATTACCCATGG + Intergenic
1065588913 10:27246341-27246363 AAGATGGAGAAGGATTCTCAAGG - Intergenic
1065804594 10:29382943-29382965 CAGAGAGAGAAGGAGTGCCATGG + Intergenic
1066451425 10:35533528-35533550 CAGAGGGAGCTGGGTGCCAAGGG - Intronic
1066591219 10:36996433-36996455 CCGTGGGAGAAGAGTCCCCATGG + Intergenic
1069643499 10:69973049-69973071 CAAAGGGGGAAGGAATCCCAAGG + Intergenic
1070353650 10:75617732-75617754 CTGAGGGAGAAAGGAACCCATGG - Intronic
1070653478 10:78254651-78254673 AAGAGGGAGGTGGGTTCCTAGGG + Intergenic
1070810948 10:79297919-79297941 GAGAGGGAGAGGGGTTCCTGGGG + Intronic
1074943449 10:118257286-118257308 CAGAGGGAGGAGGCTGGCCATGG + Intergenic
1075374332 10:121965848-121965870 CAGAAGGAAAAGGAATCCCATGG - Intronic
1075472569 10:122703962-122703984 CAGAGGGTGAGGAGTCCCCAGGG - Intergenic
1075744044 10:124714089-124714111 AAGTGCGAGAAGGGTTCCGAGGG + Intronic
1076758761 10:132589561-132589583 TACAGGCAGAAGGCTTCCCAAGG - Intronic
1077252297 11:1566049-1566071 CAGAGGGAGAAGGGTTCCCACGG - Intronic
1077440224 11:2565272-2565294 CAGAGTGACAAGTGCTCCCAAGG - Intronic
1078107352 11:8366575-8366597 CAGAGGGGAAAGGGAACCCAGGG - Intergenic
1078397820 11:10997195-10997217 CATGGGAAGAAGGGCTCCCAAGG + Intergenic
1079158689 11:17973223-17973245 CAGGGGGAGCTGTGTTCCCATGG - Intronic
1079161102 11:17995061-17995083 CAGAGGGAGAAAGGCCCACAAGG + Intronic
1079871045 11:25798372-25798394 TAGAGGGAGAATTGTCCCCAAGG + Intergenic
1081838566 11:46178004-46178026 CAAAGGGAGAAGAATACCCAGGG + Intergenic
1081867691 11:46368552-46368574 CAGGGGCAGAAGGGTTCGCATGG + Intronic
1083626483 11:64074589-64074611 CAATGGGAGAAGGGCTGCCACGG - Intronic
1083860709 11:65418546-65418568 CAGAGGGAGGGGGTCTCCCATGG - Intergenic
1084320994 11:68373326-68373348 GACAGGGAGCAGCGTTCCCAGGG + Intronic
1084485494 11:69445421-69445443 CAGAGGCAGAAGGAGACCCATGG - Intergenic
1084517919 11:69646472-69646494 CAAAGGGAGAGGGGCCCCCACGG - Intronic
1088096402 11:106105835-106105857 CAGAGGGACAAATGATCCCAGGG - Intergenic
1089179134 11:116568945-116568967 CGGAGTGAGAAGGTTTCCCTGGG - Intergenic
1089248164 11:117137569-117137591 CAGAGGGCGATGGGCTCCCTAGG - Intergenic
1089258548 11:117206992-117207014 CAGAGGGCGATGGGCTCCCTAGG + Intronic
1089268838 11:117287268-117287290 CAGAGGGAGAAGGGAGAACAGGG - Exonic
1089765115 11:120757563-120757585 GAAAGGGAGAAGAGTTCCCTGGG + Intronic
1090499820 11:127250523-127250545 AAGGAGGAGAAGGGTTACCAAGG + Intergenic
1090603279 11:128394615-128394637 GAGAGGGAGAAAGATTCTCATGG + Intergenic
1091689599 12:2586778-2586800 CACAGGGAGTCTGGTTCCCAAGG - Intronic
1091778497 12:3199807-3199829 CACAGGGAGAAGGGACCGCAGGG - Intronic
1093512269 12:19943518-19943540 AGGAGGTAGAAGCGTTCCCAGGG + Intergenic
1096528976 12:52231762-52231784 CAGAGGCGGAGGGGTGCCCAAGG - Intergenic
1096666544 12:53170107-53170129 CAGAGGGAAAATGGTCCCCGAGG - Exonic
1097137930 12:56875018-56875040 CAGAGGGAGGCTGGTTGCCAGGG + Intergenic
1097267389 12:57754326-57754348 CTGAGGGAAAAGGGATTCCAGGG - Intronic
1097290097 12:57907228-57907250 CAGTGGGAGAGGGGTTGCAAGGG - Intergenic
1102927231 12:116835623-116835645 TAGATGGAGAAGGGTTATCAGGG + Intronic
1102950403 12:117027249-117027271 CAGAGGGAACAGGGCCCCCATGG - Intronic
1103133417 12:118487798-118487820 AACAGGGAGAAGGGTTCAGATGG + Intergenic
1104314461 12:127684087-127684109 CAGAGGGAGATGGATCCACACGG + Intergenic
1105719836 13:23102124-23102146 CAGAGTAGGAAGGGTTTCCAGGG + Intergenic
1107631948 13:42351414-42351436 CAGAGGGAGAAGGGAGCACCAGG - Intergenic
1109780635 13:67106729-67106751 CAGGGGCAGAAGGGTTTCCCAGG - Intronic
1111693406 13:91592937-91592959 CAGAGGGAGATGGGGACCCTGGG + Intronic
1113598078 13:111548324-111548346 CAGCGGGAGTGGGGTTCCCAGGG - Intergenic
1113632493 13:111897713-111897735 GAGAGTGAGAGGGGTCCCCACGG + Intergenic
1113656989 13:112073299-112073321 CTGAGGGAGATGGGCTCCCAGGG - Intergenic
1114012509 14:18385209-18385231 CGGAGGGAGAAGGGGTACAAGGG - Intergenic
1114492839 14:23113948-23113970 CAGAGGGAGGAAGCTGCCCAAGG - Intergenic
1114565849 14:23632232-23632254 CAGAAGGAGAGGAGTTCCCCAGG + Intronic
1118294863 14:64559482-64559504 GAGACAGAGAAGGCTTCCCAAGG + Intronic
1118734606 14:68692255-68692277 GAGAGGGAGAAAAGTTTCCAGGG - Intronic
1119298158 14:73549855-73549877 GAGAGGAGGAAGGGCTCCCAGGG - Intronic
1119302447 14:73582039-73582061 GAGAGGAGGAAGGGCTCCCAGGG - Intergenic
1120189358 14:81426397-81426419 CAGCTGGAGAAGGGGTCCTAGGG - Intronic
1121104718 14:91272802-91272824 CAGAGGGAGACGGGGTCCCGGGG - Exonic
1121827499 14:97022481-97022503 CAGGGGGAGAAGGGTAGACAGGG - Intergenic
1123989471 15:25672878-25672900 GGGAGGGAGAAGGGGTCCTAGGG + Intergenic
1127024598 15:54789756-54789778 CAGTTGGAGAAGGCTTCCCAGGG - Intergenic
1128498295 15:68210583-68210605 CAGAGGGAGGAGGGCTCCGAAGG - Intronic
1129706446 15:77797202-77797224 CAGAGGAAGAAGCTTTCCCCAGG - Intronic
1129868365 15:78925641-78925663 CAGAGGGTGCAGGGTTTCCTAGG - Intronic
1129893882 15:79089914-79089936 CAGAGGAAGATGGGGTCCTAAGG - Intronic
1130139196 15:81209365-81209387 CAGAGGGATATGGGCTCGCAGGG + Intronic
1130141417 15:81229369-81229391 CAGAGGGATATGGGCTCGCAGGG + Intronic
1130980723 15:88810293-88810315 CAGAGCCAGAAGGTGTCCCAAGG - Intronic
1132601361 16:774553-774575 CAGAGGGGCAGGGGCTCCCAGGG - Intronic
1133168526 16:3965558-3965580 CAGAGGCAGCGGGGTTTCCAGGG + Exonic
1133698748 16:8289493-8289515 CAGATGGAAAAGGGAGCCCAAGG - Intergenic
1133809326 16:9149088-9149110 CAGAGGGACGAGGGTTTCTAGGG - Intergenic
1133978610 16:10617675-10617697 CAGACGGAGAGGGGCTCCGATGG + Intergenic
1134018318 16:10904678-10904700 CAGAGGGAGGGGGGTCCCCAGGG + Intronic
1134213081 16:12294512-12294534 CAGAGGGAGGCGGGTGCCTATGG - Intronic
1134268844 16:12715986-12716008 TAGAGGGAGAAGGGTTGGCAAGG + Intronic
1134584932 16:15402115-15402137 GAGAAGGAGAAGGTTTCCAAGGG + Intronic
1135252001 16:20908121-20908143 CAGAGGGGACAGGGTTGCCACGG + Intronic
1136010551 16:27360772-27360794 CAGTGGGAGAAGCGGTCCCGAGG + Exonic
1136240282 16:28939060-28939082 GAGAGGGAACAGGGTTCCTAGGG + Intronic
1138096374 16:54215114-54215136 CACAGTGAGAAGGACTCCCATGG - Intergenic
1138342756 16:56301439-56301461 CAGAGGAAAAAGGGGGCCCAGGG - Intronic
1138830001 16:60363786-60363808 CAAAGGGAAAATGGTTGCCAGGG - Intergenic
1139369508 16:66458093-66458115 TAGAGGGAGAAGGGGGGCCAAGG - Intronic
1139730333 16:68938762-68938784 CAGAAGGAAAAGTGTTCCTAGGG + Intronic
1139951946 16:70676856-70676878 CAGTGGGGGTGGGGTTCCCAGGG - Intronic
1140419658 16:74807785-74807807 CAGAAGGAGCGGGGTTCCCATGG + Intergenic
1141170085 16:81685432-81685454 CAGAGGAATCAGGGTCCCCACGG - Intronic
1141451666 16:84107650-84107672 CAGAGGGACTGGGGTCCCCAAGG + Intronic
1141480318 16:84301972-84301994 CAGAGGCAGATGGATGCCCATGG + Intronic
1141995835 16:87635923-87635945 CAGAGGAAGGTGGGTTCGCAGGG - Intronic
1142548056 17:719316-719338 AAGAGGGAGAAGGGGTATCATGG - Intronic
1142599240 17:1045281-1045303 CAGAGGCAGAAAGGTCACCATGG - Intronic
1142885611 17:2910510-2910532 CAGTGGGAGAAGGCTTCACCTGG + Intronic
1144185249 17:12790186-12790208 CAGAGGGAGAAGGGAGTCCCGGG - Intronic
1144330298 17:14217218-14217240 CAGAGTGAGGAGGTTTCCCTAGG + Intergenic
1144624420 17:16837556-16837578 CAGAGGGAGCAGGGTTCCTGGGG + Intergenic
1144882007 17:18435164-18435186 CAGAGGGAGCAGGGTTCCTGGGG - Intergenic
1145150226 17:20509222-20509244 CAGAGGGAGCAGGGTTCCTGGGG + Intergenic
1145950450 17:28812731-28812753 CAGAGGGAGAAGGGGTGCAAAGG - Intronic
1146957356 17:36943242-36943264 CAGAAGGAGAATGGTTCTCGAGG - Exonic
1147121509 17:38337868-38337890 CACAGAGGGAAGGCTTCCCAAGG - Intronic
1147163402 17:38580387-38580409 CAAGGGAAGAAGGGCTCCCATGG + Intronic
1147290688 17:39440145-39440167 GAAAGGGAAAAGGGTTCCTATGG + Intronic
1147426354 17:40347658-40347680 TACAGGGAGAAGAGTCCCCAGGG - Intronic
1148000094 17:44382820-44382842 GAGAGGGAGGAGGGAACCCAGGG - Intronic
1148646578 17:49222854-49222876 CGGAGGGAGAAGGGGTCCTGGGG + Exonic
1149519748 17:57309824-57309846 CAGTGGCAGAAGGGTTCTCGAGG + Intronic
1149643221 17:58218810-58218832 CAGAGGAGGTAGGGTTGCCAAGG + Intronic
1151336608 17:73443694-73443716 CACAGTGAGAAAGGGTCCCAGGG + Intronic
1151367505 17:73626923-73626945 AAGATGGAGAAGGGGTCACAGGG - Intronic
1152089897 17:78240538-78240560 CTGCAGGAGAAGGGTTCCCAGGG + Exonic
1152333130 17:79685038-79685060 CAGAGGGAGGAGGATGCCCTTGG + Intergenic
1152410223 17:80119356-80119378 CAGAGGGAGGCTGGTTCCCCAGG + Intergenic
1152649313 17:81484581-81484603 CAGGGCGCGAAGGGGTCCCAAGG - Intergenic
1152933980 17:83125277-83125299 GAGAGGGATAGGGGTTGCCAGGG - Intergenic
1154008643 18:10557011-10557033 AAGAGGGAGAAAGGGTGCCATGG - Intergenic
1157202089 18:45668072-45668094 AAGAGGAAGAATGGTCCCCATGG - Intronic
1158060982 18:53341215-53341237 CAGAGGGAGGGAGGTGCCCATGG + Intronic
1158215453 18:55096333-55096355 CAGAGGGAGAAAGGAGGCCATGG + Intergenic
1159937767 18:74382524-74382546 CAGAGGGAGAGGCTTTGCCAGGG - Intergenic
1160554954 18:79718886-79718908 TAGAGGGAGACGGGTGCTCACGG + Intronic
1160657761 19:282042-282064 CAGTGGGGCAAGGGTACCCAGGG + Intronic
1160710620 19:549446-549468 AAGAAGGAGCAGGGTTCACAGGG + Intronic
1160837301 19:1130976-1130998 CAGAGGGAGACGGGGTTCCCAGG + Intronic
1160968195 19:1755782-1755804 AGGAGGGAGGAGGGTCCCCAGGG - Intronic
1160983871 19:1828562-1828584 CAGAGGGAGAATGGCACCCTGGG - Exonic
1161138618 19:2635242-2635264 CAGATGGAGATGGGTTCACGGGG - Intronic
1161390815 19:4019353-4019375 CAGAGGGAGGAGCCCTCCCAGGG + Intronic
1161498345 19:4599174-4599196 CAGGGGGACAACGTTTCCCATGG - Intergenic
1161507300 19:4650763-4650785 CAGGGGGTGATGGGTTCACAGGG - Intronic
1161581068 19:5081407-5081429 CAGAGTGGGGAGGGTTCCTAGGG + Intronic
1162795354 19:13084486-13084508 CAATTGCAGAAGGGTTCCCAGGG + Intronic
1163267816 19:16232246-16232268 CACAGTGAGAAGGGCTCCCCGGG - Intronic
1163581524 19:18142151-18142173 CAAAGGGAGCAAGGTTGCCAGGG - Intronic
1164158058 19:22608288-22608310 CTGGGGGCGAGGGGTTCCCAGGG + Intergenic
1166393725 19:42424147-42424169 CAGAGGGAGAAAGATCCCCCAGG - Intronic
1167354599 19:48995494-48995516 CAGAGGGAGGAGGCTTCCTCTGG + Intronic
1168073130 19:53963519-53963541 CAGAGGAGGAGGGGTGCCCAAGG - Intronic
1168096738 19:54120128-54120150 GAAAGGGAGAAGGGGGCCCAGGG + Intronic
1168101003 19:54140942-54140964 CAGAGAGAGAAGAGGTCTCATGG - Intronic
1168694180 19:58395680-58395702 CAGAGGGAGGAGGCTTCCACAGG + Intergenic
925615850 2:5744011-5744033 CGGAGGGAGAAGTTTCCCCAGGG + Intergenic
926363022 2:12107931-12107953 CAGAGGGAGCAGTGTCCTCATGG - Intergenic
926973665 2:18491756-18491778 CAGAGGGAAGAGGCTTTCCAAGG - Intergenic
927451774 2:23215057-23215079 CAGATGGGGAAGGGAGCCCATGG + Intergenic
927913122 2:26915460-26915482 CAGAATGGGAAGGGGTCCCAGGG - Intronic
929874362 2:45784281-45784303 CAGAGGGAGCAGTGTTGACAAGG + Intronic
929882190 2:45846787-45846809 CACAGGGATAATGGTTCCTATGG + Intronic
929958696 2:46480019-46480041 CAGAGGGAGAAAGAAACCCAGGG - Intronic
930513723 2:52380090-52380112 CAGTGGGAGAAGGGTTGCAAGGG + Intergenic
932749625 2:74363136-74363158 CAGAGGGGGCAGGGATGCCAAGG + Exonic
935086499 2:99851072-99851094 CTCAGAGAGAAGGGTTCACACGG + Intronic
935730362 2:106060043-106060065 CAGAGGGAGAACCCTGCCCAAGG - Intergenic
936821312 2:116525031-116525053 GGGAGGCAGAAGGGTACCCAAGG - Intergenic
938408563 2:131045997-131046019 CAGAGGGTCATGGGTGCCCAGGG - Intronic
938595693 2:132785111-132785133 CAGAGGGAGAGGGGCCCACAGGG - Exonic
939409719 2:141808767-141808789 AAGTGGGAGAGGGGTTGCCAGGG - Intronic
940526728 2:154825210-154825232 AAGAGTGAGAAGGCTTCCAAAGG - Intronic
942654091 2:178196150-178196172 GAGAGTTAGCAGGGTTCCCAAGG + Intronic
944284195 2:197929995-197930017 GAGAGGGAAAAAGATTCCCATGG + Intronic
945942750 2:215966144-215966166 GGGAGGGAGAGGGGGTCCCAGGG + Intronic
946117304 2:217474554-217474576 TGGAGGGAGAAAGTTTCCCATGG + Intronic
947173500 2:227336900-227336922 CAAATGCAGAAGGGCTCCCAGGG + Intronic
947432499 2:230043473-230043495 CAGTGGGTGAAGGAATCCCATGG - Intronic
948950124 2:241244444-241244466 CAGAGGGAGAAGGTTTGTCATGG + Intronic
1169348580 20:4850019-4850041 CAGTAGGAGAAGGGTCCCGAGGG + Intergenic
1171021644 20:21589518-21589540 AAGAGGGAGAGGGGTTCAAATGG - Intergenic
1172805580 20:37609418-37609440 CAGAGGGTGAAGGGAGCTCAAGG - Intergenic
1173197429 20:40927482-40927504 TAGAAGGAAAAGGGTTCTCAAGG + Intergenic
1173932240 20:46830434-46830456 CAGAGGGAGTATGGCCCCCAAGG - Intergenic
1174117609 20:48237979-48238001 CTGAGGCAGGAGGGTTCTCAAGG - Intergenic
1174163903 20:48571168-48571190 CTGAGGCAGGAGGGTTCTCAAGG + Intergenic
1174164782 20:48576917-48576939 CAGAGGGAGATGGCTGCCCCTGG - Intergenic
1174563460 20:51447549-51447571 CAGCGGGAAAGGGGTTGCCATGG - Intronic
1175163459 20:57025827-57025849 CAGTGGGAAAACGGTTTCCATGG + Intergenic
1175586172 20:60141896-60141918 AATGGGGAGAAGGGTCCCCAAGG - Intergenic
1175738217 20:61401858-61401880 AAGAAGGAGAAGGGAGCCCAGGG + Intronic
1175775046 20:61647831-61647853 CAGAGGGAGAACAGCCCCCAGGG + Intronic
1175931109 20:62494133-62494155 CAGAGGAAGAAGAGGCCCCATGG - Intergenic
1176300869 21:5098342-5098364 CATAGGGAGCAGGGTCCACAGGG + Intergenic
1177158968 21:17527717-17527739 CAAAGGATGAGGGGTTCCCAAGG - Intronic
1177175664 21:17698652-17698674 CAGAAGGAGAAGGTTTTGCATGG + Intergenic
1178925779 21:36773712-36773734 AAGAGGGAGAAGGGGGCCCCAGG + Intronic
1179856167 21:44163611-44163633 CATAGGGAGCAGGGTCCACAGGG - Intergenic
1179885451 21:44312371-44312393 CAGAGGGACGAGGGATCCCTGGG + Intronic
1180437000 22:15316018-15316040 CGGAGGGAGAAGGGGTACAAGGG - Intergenic
1180725974 22:17946865-17946887 CAGAGGGAGGGGTGTTCCCCAGG - Intronic
1180898308 22:19353317-19353339 CAGAAGGAGAAGGCTGCTCAGGG + Intronic
1181419623 22:22788857-22788879 CAGAGGGAGAAGGGGTGGCGGGG - Intronic
1181428156 22:22857176-22857198 CTGAGGGAGAAGAATTCTCAAGG - Intronic
1181788472 22:25244444-25244466 CAGAGGGTGAAGGGGAGCCATGG - Intergenic
1181820153 22:25469142-25469164 CAGAGGGTGAAGGGGAGCCATGG - Intergenic
1182070892 22:27462952-27462974 CAGAGGTTGAGGGGTTTCCAGGG + Intergenic
1182550925 22:31100389-31100411 CAGATGGAGAAGGGTGCTGAGGG - Intronic
950315835 3:12001562-12001584 CAGAGGAAGAAGAGATCTCAGGG - Intergenic
950467138 3:13162253-13162275 CAGAGGGAGAAGGGCACCTTGGG + Intergenic
950484483 3:13265024-13265046 CAGGGGGAGAAGGGGTATCAGGG - Intergenic
950553661 3:13682475-13682497 CACAGGGAGAAGGGTGGCCCTGG + Intergenic
950765379 3:15269402-15269424 CAGAGGGACGAGGTTTTCCAGGG - Intronic
952388061 3:32857154-32857176 CAGAGGGAACAGGGGACCCAGGG - Intronic
952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG + Exonic
953714875 3:45308617-45308639 CAGAGGGAGGTGGGTTGCTAGGG + Intergenic
954391101 3:50268298-50268320 CAGAGGGAGAAGTGCTACCCAGG - Intronic
954638692 3:52085371-52085393 CAGAGGGTGAAGGGTGTCCCAGG - Intronic
957255065 3:77825855-77825877 CAGAGGGAGATGGGCAGCCATGG + Intergenic
961437409 3:126928897-126928919 CAGAGGAAGTAGAGTTCCCAGGG - Intronic
961748048 3:129078472-129078494 CAGAGGAAGAAAGGCTCCAAAGG + Intergenic
962210289 3:133471907-133471929 CAGAGGGAGAAGGGGTCCCCCGG + Intronic
962458156 3:135584195-135584217 AAGTGGAAGATGGGTTCCCAGGG - Intergenic
962525265 3:136232479-136232501 CAGAGGGAGAAGTTGTCTCAAGG + Intergenic
964640840 3:158908801-158908823 CAGAGGGATAAGACTTACCAGGG - Intergenic
965018258 3:163189764-163189786 CAGAGAGAAAAGGTCTCCCATGG - Intergenic
966072440 3:175895397-175895419 CTGAGGGACAAGGGTGGCCAAGG - Intergenic
966620019 3:181953319-181953341 CAGAGGGAGAAGGGGTTTCTGGG + Intergenic
967684027 3:192398874-192398896 CAGAGGAAGAAGGATTCTGAAGG - Intronic
967821499 3:193843041-193843063 CAGAGGGAGGGCAGTTCCCAGGG + Intergenic
968985355 4:3871819-3871841 CAGAGGGAGCGGGGTTCGCGGGG + Intergenic
969562581 4:7959072-7959094 CTGTGGGTGAAGGGTCCCCATGG + Intergenic
971173755 4:24261288-24261310 CTGAGGGAGAAGGAGTGCCAGGG - Intergenic
971216358 4:24665793-24665815 GAGAGTGAGAAGTGCTCCCAAGG + Intergenic
971418528 4:26455170-26455192 CAGCAGGGGAAGGGTGCCCAGGG - Intergenic
971495575 4:27260860-27260882 CAGATGCAGAAGGTTTCACATGG - Intergenic
972900790 4:43680615-43680637 CAGTTGGAGCACGGTTCCCATGG + Intergenic
974771656 4:66422498-66422520 CAGAAGGAGCAGGTTTCCAAAGG + Intergenic
979026585 4:115585068-115585090 AAGAGGGAGAAAGGTTGGCAAGG - Intergenic
979542593 4:121902887-121902909 CAGAAGGAGAAGGCTTCAGAAGG - Exonic
979904346 4:126266767-126266789 CACATGGGGAAGGTTTCCCAAGG + Intergenic
980831543 4:138134457-138134479 CAGAGGGAGAGGATTTCCCTGGG - Intergenic
981062555 4:140441016-140441038 CACAAGGAGATGTGTTCCCACGG + Intergenic
983865102 4:172757149-172757171 CAGAGGGCAAAGGTTTGCCAAGG - Intronic
985893979 5:2738571-2738593 GAGAGGGTGAAGGCTTCCCTGGG - Intergenic
987147097 5:15002576-15002598 CAAAGGGAGAAGGCTTGCCTGGG - Intergenic
987637746 5:20567421-20567443 AAGATGGAGAAGGGGCCCCATGG + Intronic
988205997 5:28135216-28135238 CAGAGGGTGAAGTTTTCCCTTGG + Intergenic
989257508 5:39381316-39381338 AAGTGGGAGAAGGGCTCCCTGGG + Intronic
991929883 5:71743841-71743863 CAGAAGGAGAGGGGTTCTCTTGG + Intergenic
993138693 5:84002873-84002895 CAGGGGTTGAAGGGTTCACAGGG - Intronic
994030470 5:95136149-95136171 GAGAGGGAGAAGGGATACCAAGG - Intronic
994303211 5:98171811-98171833 CAGAGGAAGCAGTGTTCTCAGGG - Intergenic
995749561 5:115440054-115440076 CAGAGGGAGAAGGGTGGAGAAGG - Intergenic
996481498 5:123980673-123980695 CAGATGGAGAAGTGTACCCCAGG + Intergenic
997512495 5:134463257-134463279 CAGAGAGAGCAGGGTTGACAGGG - Intergenic
999174923 5:149625433-149625455 CAGAGGGAGAATGGGGCCCCAGG + Intronic
1006580332 6:35073380-35073402 CAGAGGAAAAAGTGCTCCCATGG - Intronic
1007050635 6:38825151-38825173 CTGAGGGAAAAGGGTCCCCTAGG + Intronic
1007182778 6:39942454-39942476 CAGGTGGAGAATGGATCCCAGGG - Intergenic
1007403064 6:41615595-41615617 CAGAGGGAGGAGGGATTTCAGGG + Intergenic
1008906453 6:56682517-56682539 CAGAGGGAGAAGGGAAAACATGG - Intronic
1010669742 6:78674018-78674040 CAGAGGGTGAGGACTTCCCAAGG + Intergenic
1011623633 6:89265825-89265847 CAGTGAAAGACGGGTTCCCAGGG - Intronic
1012709446 6:102581461-102581483 CAGTGGGGGAGGGGTTGCCAGGG + Intergenic
1013276925 6:108594466-108594488 CAGCAGGAGGAGAGTTCCCAGGG + Intronic
1014146682 6:118005858-118005880 CAGAGGAAGAAGTGATCCTATGG - Intronic
1015108261 6:129563081-129563103 CAGAGGAATAAGGTTTCTCAAGG - Intergenic
1016806664 6:148218779-148218801 GAGAAGCAGAAGGGTTCACAAGG - Intergenic
1017481294 6:154858842-154858864 CAGAGAAAGAAGGCTTCTCAAGG - Intronic
1017744182 6:157432106-157432128 CTGAAGGAAAAGGGCTCCCAAGG + Intronic
1017945892 6:159095928-159095950 CTGAGGGAAGAGGGTTCCCCAGG + Intergenic
1018101316 6:160443323-160443345 CTGAGGGAGAAGTGTGCCCAGGG - Intronic
1018103753 6:160464350-160464372 GAGAGGGAGAAGGTGTTCCAAGG + Intergenic
1018131214 6:160733929-160733951 GAGAGGGAGAAGGTGTTCCAAGG - Intronic
1018619698 6:165718037-165718059 CAGAGTGAGAAGGTAACCCACGG - Intronic
1019090931 6:169533101-169533123 CAGAGGAAGACAGGCTCCCAGGG + Intronic
1019176671 6:170162763-170162785 CAGAGGAAGGAGGGCTGCCATGG - Intergenic
1019609373 7:1929201-1929223 AAGAGGGAGAAGAGATACCAGGG - Intronic
1020140812 7:5610646-5610668 CAGAGGGAGAAGGGAACAGATGG + Intergenic
1020223135 7:6256821-6256843 CAGAGGGAGCAGAGTCCACATGG - Intronic
1023246515 7:38210662-38210684 CAGAGGGAAAAGAGTCCTCAGGG - Intronic
1024865180 7:53897510-53897532 GAAAGAGAGAAGGGTTGCCAAGG - Intergenic
1027263478 7:76481024-76481046 CAGAGGTTGAAGGGTTCCTTTGG + Intronic
1027314850 7:76979123-76979145 CAGAGGTTGAAGGGTTCCTTTGG + Intergenic
1028258298 7:88628660-88628682 CAGTGGGAGATGGGCTCCAAAGG + Intergenic
1029460176 7:100689717-100689739 CAGAGGAAGGAGAGGTCCCAGGG - Intergenic
1030901792 7:115133310-115133332 CAGTGGGAGAAAGTTTCTCATGG - Intergenic
1030995351 7:116352790-116352812 CAGAGGCAGGAGTGTGCCCAAGG + Intronic
1033705205 7:143879861-143879883 CTGAGGGAGAAGGGTTCTGATGG - Intronic
1034274789 7:149819368-149819390 CTGCGGGAGCAAGGTTCCCACGG - Intergenic
1035027185 7:155833787-155833809 CAGAGGCAGGCAGGTTCCCAGGG - Intergenic
1035235262 7:157493673-157493695 CAGAGGCAGAAAGCTTCCCTGGG - Intergenic
1036064898 8:5368990-5369012 CAGAGGGAGAAAGGTGCACGTGG - Intergenic
1036655529 8:10674761-10674783 CAGTGGGCAAAGGCTTCCCATGG + Exonic
1036961929 8:13254126-13254148 AGGAGGGAGAAGGATTTCCAGGG - Intronic
1037244352 8:16815190-16815212 CAGAAGGGGAAGGGGTCGCAAGG + Intergenic
1037453364 8:19039153-19039175 CAGAGAAAAAAGGATTCCCATGG - Intronic
1038328824 8:26591766-26591788 CAGAGGCAGAGGGGCTGCCATGG - Intronic
1041723818 8:60999859-60999881 TACAGGGAGAAAGGTTCACAGGG + Intergenic
1048046864 8:130780907-130780929 CAGAGGGAGAAGGGGGACAATGG + Intronic
1049361933 8:142216059-142216081 CTGAGGGGGAAAGGTTCCCATGG + Intronic
1049377112 8:142294539-142294561 CAGAGGAGGCAGGGTGCCCACGG - Intronic
1049431299 8:142566536-142566558 CAGAGGGAGAGGAAATCCCAGGG - Intergenic
1049444388 8:142623387-142623409 CAGAGGGACATGGGCTCACATGG - Intergenic
1049675659 8:143887732-143887754 CAAGGGGAGGAGGGGTCCCAGGG + Intergenic
1049702537 8:144021691-144021713 CTGAGGGGGAAGGGTTTTCAGGG - Intronic
1049702590 8:144021917-144021939 CTGAGGGGGAAGGGTTTTCAGGG - Intronic
1049702635 8:144022093-144022115 CTGAGGGGGAAGGGTTTTCAGGG - Intronic
1049702742 8:144022538-144022560 CTGAGGGGGAAGGGTTTTCAGGG - Intronic
1049744101 8:144255881-144255903 CAGTGTGAGAAGGGTGGCCATGG - Intronic
1049997628 9:1046969-1046991 CAGAGGGGGAAGGGGGCCCCAGG + Intergenic
1051869471 9:21720208-21720230 CAGAGCTGGAAGGGTTACCAAGG - Intergenic
1053073575 9:35115120-35115142 CAGCGGGGGAAGGGTCCCCCGGG + Intronic
1056487747 9:87075942-87075964 CACAGGGAGAAGGCATGCCAAGG + Intergenic
1056803737 9:89712435-89712457 CGGAGGGAGGAGGGAGCCCAGGG - Intergenic
1057034364 9:91801007-91801029 CATAGGTAGCAGAGTTCCCAGGG - Intronic
1057079666 9:92163471-92163493 CAGAGGGAGGAAGGTGCCAATGG - Intergenic
1060298938 9:122362737-122362759 GAGAGGGAGAGGGGTTTGCAAGG - Intergenic
1060512356 9:124243174-124243196 CAGAGGGAGAAGGGCCCAGACGG + Intergenic
1060980788 9:127790469-127790491 CAGAGGGTGAAGGGATCACAGGG + Exonic
1061117029 9:128620286-128620308 CAGCGGGAGGATGCTTCCCATGG - Intronic
1061306822 9:129737150-129737172 CAGAGGGAGGACAGATCCCAGGG - Intergenic
1061536223 9:131252001-131252023 CACAGGGAGGAGGGTTCCGGGGG - Intergenic
1062215054 9:135384593-135384615 CAGGGGCGGAAGGGTCCCCAGGG - Intergenic
1062525233 9:136975607-136975629 CATAGCCAGAGGGGTTCCCAGGG - Intergenic
1062658329 9:137615381-137615403 CAGAGGCTGGAGGGTGCCCAAGG - Exonic
1187135397 X:16542702-16542724 CAGAGGGAGAAGGGTGTCTCCGG + Intergenic
1187948870 X:24452660-24452682 CAGAGGGGGAAGGGGAGCCAGGG + Intergenic
1188274869 X:28187697-28187719 CAGAGGATGAACGGTTCACAGGG - Intergenic
1189017848 X:37302778-37302800 CAGAACAAGAAGGTTTCCCATGG + Intergenic
1191110837 X:56802337-56802359 CAGAGGGCCAAGGGTCCCAAGGG - Intergenic
1198139689 X:133790312-133790334 CAGAGAGAGAAATGTTCCAAGGG - Intronic
1198561614 X:137856481-137856503 GAGAGGATGAAGAGTTCCCAGGG - Intergenic
1199905922 X:152229591-152229613 CTGAGGTAGAAGTGTGCCCAGGG + Intronic