ID: 1077253923

View in Genome Browser
Species Human (GRCh38)
Location 11:1572292-1572314
Sequence CGGGGCCGCCGGCGGGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077253905_1077253923 15 Left 1077253905 11:1572254-1572276 CCGCGCTCGGCCGCGAGTGACAG No data
Right 1077253923 11:1572292-1572314 CGGGGCCGCCGGCGGGGATGAGG No data
1077253904_1077253923 18 Left 1077253904 11:1572251-1572273 CCGCCGCGCTCGGCCGCGAGTGA No data
Right 1077253923 11:1572292-1572314 CGGGGCCGCCGGCGGGGATGAGG No data
1077253918_1077253923 -10 Left 1077253918 11:1572279-1572301 CCGGGGCGGAGGGCGGGGCCGCC No data
Right 1077253923 11:1572292-1572314 CGGGGCCGCCGGCGGGGATGAGG No data
1077253903_1077253923 27 Left 1077253903 11:1572242-1572264 CCGGCTCGGCCGCCGCGCTCGGC No data
Right 1077253923 11:1572292-1572314 CGGGGCCGCCGGCGGGGATGAGG No data
1077253917_1077253923 -9 Left 1077253917 11:1572278-1572300 CCCGGGGCGGAGGGCGGGGCCGC No data
Right 1077253923 11:1572292-1572314 CGGGGCCGCCGGCGGGGATGAGG No data
1077253910_1077253923 5 Left 1077253910 11:1572264-1572286 CCGCGAGTGACAGGCCCGGGGCG No data
Right 1077253923 11:1572292-1572314 CGGGGCCGCCGGCGGGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077253923 Original CRISPR CGGGGCCGCCGGCGGGGATG AGG Intergenic
No off target data available for this crispr