ID: 1077255270

View in Genome Browser
Species Human (GRCh38)
Location 11:1578963-1578985
Sequence TGGGAATGTATAGGAATAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077255270_1077255274 2 Left 1077255270 11:1578963-1578985 CCAATTATTCCTATACATTCCCA No data
Right 1077255274 11:1578988-1579010 TATAGTCCCAATTGTATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077255270 Original CRISPR TGGGAATGTATAGGAATAAT TGG (reversed) Intergenic
No off target data available for this crispr