ID: 1077259064

View in Genome Browser
Species Human (GRCh38)
Location 11:1605960-1605982
Sequence AAATTAGCCAGGCATGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183666
Summary {0: 8580, 1: 28158, 2: 52537, 3: 58262, 4: 36129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077259064_1077259069 -2 Left 1077259064 11:1605960-1605982 CCACCACCATGCCTGGCTAATTT 0: 8580
1: 28158
2: 52537
3: 58262
4: 36129
Right 1077259069 11:1605981-1606003 TTTTGTATTTTTAGTGGAGACGG 0: 5349
1: 200405
2: 139847
3: 63740
4: 43177
1077259064_1077259070 -1 Left 1077259064 11:1605960-1605982 CCACCACCATGCCTGGCTAATTT 0: 8580
1: 28158
2: 52537
3: 58262
4: 36129
Right 1077259070 11:1605982-1606004 TTTGTATTTTTAGTGGAGACGGG 0: 4658
1: 171161
2: 209866
3: 122669
4: 67316
1077259064_1077259068 -8 Left 1077259064 11:1605960-1605982 CCACCACCATGCCTGGCTAATTT 0: 8580
1: 28158
2: 52537
3: 58262
4: 36129
Right 1077259068 11:1605975-1605997 GCTAATTTTTGTATTTTTAGTGG 0: 4035
1: 4130
2: 2442
3: 1572
4: 5236
1077259064_1077259071 0 Left 1077259064 11:1605960-1605982 CCACCACCATGCCTGGCTAATTT 0: 8580
1: 28158
2: 52537
3: 58262
4: 36129
Right 1077259071 11:1605983-1606005 TTGTATTTTTAGTGGAGACGGGG 0: 2625
1: 105157
2: 219364
3: 149560
4: 79502
1077259064_1077259074 30 Left 1077259064 11:1605960-1605982 CCACCACCATGCCTGGCTAATTT 0: 8580
1: 28158
2: 52537
3: 58262
4: 36129
Right 1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG No data
1077259064_1077259073 29 Left 1077259064 11:1605960-1605982 CCACCACCATGCCTGGCTAATTT 0: 8580
1: 28158
2: 52537
3: 58262
4: 36129
Right 1077259073 11:1606012-1606034 CATGTCCTTTTAGAAGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077259064 Original CRISPR AAATTAGCCAGGCATGGTGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr