ID: 1077259065

View in Genome Browser
Species Human (GRCh38)
Location 11:1605963-1605985
Sequence CAAAAATTAGCCAGGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 586727
Summary {0: 19376, 1: 62374, 2: 135331, 3: 184733, 4: 184913}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077259065_1077259069 -5 Left 1077259065 11:1605963-1605985 CCACCATGCCTGGCTAATTTTTG 0: 19376
1: 62374
2: 135331
3: 184733
4: 184913
Right 1077259069 11:1605981-1606003 TTTTGTATTTTTAGTGGAGACGG 0: 5349
1: 200405
2: 139847
3: 63740
4: 43177
1077259065_1077259073 26 Left 1077259065 11:1605963-1605985 CCACCATGCCTGGCTAATTTTTG 0: 19376
1: 62374
2: 135331
3: 184733
4: 184913
Right 1077259073 11:1606012-1606034 CATGTCCTTTTAGAAGTTTCAGG No data
1077259065_1077259071 -3 Left 1077259065 11:1605963-1605985 CCACCATGCCTGGCTAATTTTTG 0: 19376
1: 62374
2: 135331
3: 184733
4: 184913
Right 1077259071 11:1605983-1606005 TTGTATTTTTAGTGGAGACGGGG 0: 2625
1: 105157
2: 219364
3: 149560
4: 79502
1077259065_1077259070 -4 Left 1077259065 11:1605963-1605985 CCACCATGCCTGGCTAATTTTTG 0: 19376
1: 62374
2: 135331
3: 184733
4: 184913
Right 1077259070 11:1605982-1606004 TTTGTATTTTTAGTGGAGACGGG 0: 4658
1: 171161
2: 209866
3: 122669
4: 67316
1077259065_1077259074 27 Left 1077259065 11:1605963-1605985 CCACCATGCCTGGCTAATTTTTG 0: 19376
1: 62374
2: 135331
3: 184733
4: 184913
Right 1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077259065 Original CRISPR CAAAAATTAGCCAGGCATGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr