ID: 1077259066

View in Genome Browser
Species Human (GRCh38)
Location 11:1605966-1605988
Sequence ATACAAAAATTAGCCAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 397713
Summary {0: 19517, 1: 46347, 2: 91393, 3: 112924, 4: 127532}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077259066_1077259069 -8 Left 1077259066 11:1605966-1605988 CCATGCCTGGCTAATTTTTGTAT 0: 19517
1: 46347
2: 91393
3: 112924
4: 127532
Right 1077259069 11:1605981-1606003 TTTTGTATTTTTAGTGGAGACGG 0: 5349
1: 200405
2: 139847
3: 63740
4: 43177
1077259066_1077259071 -6 Left 1077259066 11:1605966-1605988 CCATGCCTGGCTAATTTTTGTAT 0: 19517
1: 46347
2: 91393
3: 112924
4: 127532
Right 1077259071 11:1605983-1606005 TTGTATTTTTAGTGGAGACGGGG 0: 2625
1: 105157
2: 219364
3: 149560
4: 79502
1077259066_1077259070 -7 Left 1077259066 11:1605966-1605988 CCATGCCTGGCTAATTTTTGTAT 0: 19517
1: 46347
2: 91393
3: 112924
4: 127532
Right 1077259070 11:1605982-1606004 TTTGTATTTTTAGTGGAGACGGG 0: 4658
1: 171161
2: 209866
3: 122669
4: 67316
1077259066_1077259073 23 Left 1077259066 11:1605966-1605988 CCATGCCTGGCTAATTTTTGTAT 0: 19517
1: 46347
2: 91393
3: 112924
4: 127532
Right 1077259073 11:1606012-1606034 CATGTCCTTTTAGAAGTTTCAGG No data
1077259066_1077259074 24 Left 1077259066 11:1605966-1605988 CCATGCCTGGCTAATTTTTGTAT 0: 19517
1: 46347
2: 91393
3: 112924
4: 127532
Right 1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077259066 Original CRISPR ATACAAAAATTAGCCAGGCA TGG (reversed) Intergenic
Too many off-targets to display for this crispr