ID: 1077259067

View in Genome Browser
Species Human (GRCh38)
Location 11:1605971-1605993
Sequence TAAAAATACAAAAATTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 490854
Summary {0: 73615, 1: 131241, 2: 96626, 3: 64440, 4: 124932}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077259067_1077259074 19 Left 1077259067 11:1605971-1605993 CCTGGCTAATTTTTGTATTTTTA 0: 73615
1: 131241
2: 96626
3: 64440
4: 124932
Right 1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG No data
1077259067_1077259073 18 Left 1077259067 11:1605971-1605993 CCTGGCTAATTTTTGTATTTTTA 0: 73615
1: 131241
2: 96626
3: 64440
4: 124932
Right 1077259073 11:1606012-1606034 CATGTCCTTTTAGAAGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077259067 Original CRISPR TAAAAATACAAAAATTAGCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr