ID: 1077259067 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:1605971-1605993 |
| Sequence | TAAAAATACAAAAATTAGCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 490854 | |||
| Summary | {0: 73615, 1: 131241, 2: 96626, 3: 64440, 4: 124932} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1077259067_1077259074 | 19 | Left | 1077259067 | 11:1605971-1605993 | CCTGGCTAATTTTTGTATTTTTA | 0: 73615 1: 131241 2: 96626 3: 64440 4: 124932 |
||
| Right | 1077259074 | 11:1606013-1606035 | ATGTCCTTTTAGAAGTTTCAGGG | No data | ||||
| 1077259067_1077259073 | 18 | Left | 1077259067 | 11:1605971-1605993 | CCTGGCTAATTTTTGTATTTTTA | 0: 73615 1: 131241 2: 96626 3: 64440 4: 124932 |
||
| Right | 1077259073 | 11:1606012-1606034 | CATGTCCTTTTAGAAGTTTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1077259067 | Original CRISPR | TAAAAATACAAAAATTAGCC AGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||