ID: 1077259074

View in Genome Browser
Species Human (GRCh38)
Location 11:1606013-1606035
Sequence ATGTCCTTTTAGAAGTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077259064_1077259074 30 Left 1077259064 11:1605960-1605982 CCACCACCATGCCTGGCTAATTT 0: 8580
1: 28158
2: 52537
3: 58262
4: 36129
Right 1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG No data
1077259066_1077259074 24 Left 1077259066 11:1605966-1605988 CCATGCCTGGCTAATTTTTGTAT 0: 19517
1: 46347
2: 91393
3: 112924
4: 127532
Right 1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG No data
1077259065_1077259074 27 Left 1077259065 11:1605963-1605985 CCACCATGCCTGGCTAATTTTTG 0: 19376
1: 62374
2: 135331
3: 184733
4: 184913
Right 1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG No data
1077259067_1077259074 19 Left 1077259067 11:1605971-1605993 CCTGGCTAATTTTTGTATTTTTA 0: 73615
1: 131241
2: 96626
3: 64440
4: 124932
Right 1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077259074 Original CRISPR ATGTCCTTTTAGAAGTTTCA GGG Intergenic
No off target data available for this crispr