ID: 1077259441

View in Genome Browser
Species Human (GRCh38)
Location 11:1608056-1608078
Sequence GACCCCCTTGGAACCCCCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 4, 2: 17, 3: 16, 4: 97}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077259436_1077259441 -7 Left 1077259436 11:1608040-1608062 CCCCACGAAATCCACAGACCCCC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1077259441 11:1608056-1608078 GACCCCCTTGGAACCCCCACAGG 0: 1
1: 4
2: 17
3: 16
4: 97
1077259433_1077259441 3 Left 1077259433 11:1608030-1608052 CCCTTGGAGCCCCCACGAAATCC 0: 1
1: 0
2: 0
3: 14
4: 94
Right 1077259441 11:1608056-1608078 GACCCCCTTGGAACCCCCACAGG 0: 1
1: 4
2: 17
3: 16
4: 97
1077259435_1077259441 -6 Left 1077259435 11:1608039-1608061 CCCCCACGAAATCCACAGACCCC 0: 1
1: 0
2: 2
3: 13
4: 146
Right 1077259441 11:1608056-1608078 GACCCCCTTGGAACCCCCACAGG 0: 1
1: 4
2: 17
3: 16
4: 97
1077259430_1077259441 6 Left 1077259430 11:1608027-1608049 CCCCCCTTGGAGCCCCCACGAAA 0: 1
1: 0
2: 3
3: 29
4: 103
Right 1077259441 11:1608056-1608078 GACCCCCTTGGAACCCCCACAGG 0: 1
1: 4
2: 17
3: 16
4: 97
1077259437_1077259441 -8 Left 1077259437 11:1608041-1608063 CCCACGAAATCCACAGACCCCCT 0: 1
1: 0
2: 1
3: 12
4: 157
Right 1077259441 11:1608056-1608078 GACCCCCTTGGAACCCCCACAGG 0: 1
1: 4
2: 17
3: 16
4: 97
1077259432_1077259441 4 Left 1077259432 11:1608029-1608051 CCCCTTGGAGCCCCCACGAAATC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1077259441 11:1608056-1608078 GACCCCCTTGGAACCCCCACAGG 0: 1
1: 4
2: 17
3: 16
4: 97
1077259431_1077259441 5 Left 1077259431 11:1608028-1608050 CCCCCTTGGAGCCCCCACGAAAT 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1077259441 11:1608056-1608078 GACCCCCTTGGAACCCCCACAGG 0: 1
1: 4
2: 17
3: 16
4: 97
1077259429_1077259441 12 Left 1077259429 11:1608021-1608043 CCGCAGCCCCCCTTGGAGCCCCC 0: 12
1: 22
2: 15
3: 62
4: 507
Right 1077259441 11:1608056-1608078 GACCCCCTTGGAACCCCCACAGG 0: 1
1: 4
2: 17
3: 16
4: 97
1077259438_1077259441 -9 Left 1077259438 11:1608042-1608064 CCACGAAATCCACAGACCCCCTT 0: 1
1: 0
2: 0
3: 17
4: 125
Right 1077259441 11:1608056-1608078 GACCCCCTTGGAACCCCCACAGG 0: 1
1: 4
2: 17
3: 16
4: 97
1077259434_1077259441 2 Left 1077259434 11:1608031-1608053 CCTTGGAGCCCCCACGAAATCCA 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1077259441 11:1608056-1608078 GACCCCCTTGGAACCCCCACAGG 0: 1
1: 4
2: 17
3: 16
4: 97
1077259427_1077259441 21 Left 1077259427 11:1608012-1608034 CCACAAGAACCGCAGCCCCCCTT 0: 2
1: 4
2: 7
3: 30
4: 115
Right 1077259441 11:1608056-1608078 GACCCCCTTGGAACCCCCACAGG 0: 1
1: 4
2: 17
3: 16
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077259441 Original CRISPR GACCCCCTTGGAACCCCCAC AGG Exonic
900791810 1:4685719-4685741 GTCCCCCATGGACCCCCCAACGG - Intronic
902289516 1:15427241-15427263 GGCCCCCTTGACACCCTCACTGG - Exonic
904914508 1:33960205-33960227 GACCTCCTGGGAATCCCCAGAGG + Intronic
905789302 1:40782061-40782083 GACCCCCTAGAAACACCCCCAGG + Intergenic
905827815 1:41039808-41039830 GAGCCCTGTGGAACCTCCACAGG + Intronic
915260991 1:154676767-154676789 TAACCTCTGGGAACCCCCACTGG + Intergenic
916574467 1:166055111-166055133 GGCCCCCTTGGAGCTCCCATGGG - Intergenic
917964081 1:180167603-180167625 GAGCCCAGTGCAACCCCCACTGG + Intronic
920435916 1:205947134-205947156 CACACCCTTGGCACCCACACAGG - Intergenic
920854641 1:209652644-209652666 GGGCCCCTTGCAGCCCCCACAGG - Intergenic
923363588 1:233236844-233236866 GACCCAGTCGGAAACCCCACGGG - Exonic
923434686 1:233956870-233956892 GGCCCCCTAGGAATCCACACAGG + Intronic
924421107 1:243910938-243910960 CACCCCCTTGGAACCACCTGCGG - Intergenic
1072827107 10:98618472-98618494 GACCCCCTTGGAATCAGCAGAGG - Intronic
1075407648 10:122205246-122205268 GAGACCCCAGGAACCCCCACCGG - Intronic
1076251937 10:128991628-128991650 GACCCCTTCGGGACCCCCAAGGG - Intergenic
1076522900 10:131091898-131091920 GACGGCCCTGGAACCCCCAGGGG + Intergenic
1077114009 11:874979-875001 GACCCCTCAGGAGCCCCCACAGG + Intronic
1077256225 11:1584692-1584714 GCCCCCCTTGCAGCCTCCACAGG + Exonic
1077256247 11:1584752-1584774 GGCCCCCTTGGAGCACCCACAGG + Exonic
1077256285 11:1584926-1584948 GCCCCCCTTGGAGCCCCCACAGG + Exonic
1077256307 11:1584986-1585008 GCCCCCCTTGCAGCCTCCACAGG + Exonic
1077258024 11:1597930-1597952 GCCCCCCTTGGAACCCCCACAGG + Exonic
1077258036 11:1597960-1597982 GCCCCCCTTGGAGCCCCCACAGG + Exonic
1077258048 11:1597990-1598012 GCCCCCCTTGGAGCCCCCACAGG + Exonic
1077259441 11:1608056-1608078 GACCCCCTTGGAACCCCCACAGG + Exonic
1077259458 11:1608128-1608150 GCCCCCCTTGGAGCCTCCACAGG + Exonic
1077259478 11:1608188-1608210 GACCCCCTTGGAGCCCCCACAGG + Exonic
1077261135 11:1621704-1621726 GCCTCCTTTGGAGCCCCCACAGG + Exonic
1077261144 11:1621734-1621756 GCCCCCCTTGGAACCCCCACAGG + Exonic
1077261156 11:1621764-1621786 GCCCCCCTTGGAGCCCCCACAGG + Exonic
1077261168 11:1621794-1621816 GCCCCCCTTGGAACCCCCACAGG + Exonic
1077261190 11:1621854-1621876 GCCCCCCTTGGAGCCCCCACAGG + Exonic
1077262478 11:1630142-1630164 GGCCCCCTTGGACACCCCACAGG - Exonic
1077262492 11:1630172-1630194 GCCCCCCTTGGACCCCCCACAGG - Exonic
1077262505 11:1630202-1630224 GCCCCCCTTGGACCCCCCACAGG - Exonic
1077262518 11:1630232-1630254 GCCCCCCTTGGACCCCCCACAGG - Exonic
1077262531 11:1630262-1630284 GCCCCCCTTGGACCCCCCACAGG - Exonic
1078926599 11:15880819-15880841 GCCAGCCTTGGAACCCCCACTGG + Intergenic
1079752102 11:24212649-24212671 GACTGGCTTGGAATCCCCACTGG + Intergenic
1080966200 11:37217598-37217620 GCCCCACATGGAGCCCCCACTGG - Intergenic
1084331104 11:68431167-68431189 GAACCCCCAGGAACTCCCACGGG - Intronic
1084798793 11:71527476-71527498 GCCTCCCTTGGAGCCCCCACAGG - Exonic
1084798805 11:71527506-71527528 GCCCCCCTTGGAGCCCCCACAGG - Exonic
1084800126 11:71538210-71538232 GCCCCCCTTGGAGCCCCCACAGG - Exonic
1084800138 11:71538240-71538262 GTCCCCCTTGGAGCCCCCACAGG - Exonic
1084800148 11:71538270-71538292 GCCTCCCTTGGAGCCCCCACAGG - Exonic
1084801797 11:71548848-71548870 GCCTCCCTTGGAGCCCCCACAGG - Exonic
1084803898 11:71565784-71565806 GTCCCCCTTGGAGCCCCCACAGG - Exonic
1084803920 11:71565844-71565866 GCCCCCCTTGGAGCCCCCACAGG - Exonic
1084803932 11:71565874-71565896 GCCCCCCTTGGAGCCCCCACAGG - Exonic
1084803952 11:71565934-71565956 GCCACCTTTGGAGCCCCCACAGG - Exonic
1084803964 11:71565964-71565986 GCCCCCCTTGGAGCCCCCACAGG - Exonic
1084806468 11:71582640-71582662 GCCCCCTTTGGAGCCCCCACAGG + Exonic
1084980966 11:72828578-72828600 GACCCTCTTGGAGCCCTCCCTGG + Intronic
1085261444 11:75207540-75207562 GACTTCCCTGGGACCCCCACAGG - Intergenic
1086923900 11:92618595-92618617 GGCCATCTTGGAACCCCCTCTGG + Intronic
1087063136 11:94002312-94002334 TTCCACCTTGGAACTCCCACAGG - Intergenic
1088837124 11:113587197-113587219 CACCCCCATGCAACCCCCTCAGG - Intergenic
1091251644 11:134148872-134148894 TTCCCCCTTGGAAACCACACGGG + Intronic
1091341592 11:134819663-134819685 GAGGCCCTGGGAACCCACACAGG + Intergenic
1094828938 12:34291082-34291104 GACCCCCGCGGAACCCACGCAGG + Intergenic
1096475574 12:51907192-51907214 GACCCCTATGGGACCCCCACAGG + Intronic
1102908215 12:116693761-116693783 GACCCCCGTGCGACTCCCACTGG - Intergenic
1104994502 12:132645156-132645178 GACCCCCCAGGACCCCACACAGG - Intronic
1104994519 12:132645210-132645232 GACCCCCCAGGACCCCACACAGG - Intronic
1110409180 13:75185143-75185165 GAAGCCCCTGGGACCCCCACAGG + Intergenic
1114361564 14:21979198-21979220 GACCCTCTTGAAAGCTCCACAGG - Intergenic
1122263125 14:100534452-100534474 CAGCCCCTTGGGAGCCCCACAGG + Intergenic
1122569235 14:102683569-102683591 GACCCCCGGGGAAGCCCCGCTGG - Intronic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1129934148 15:79435360-79435382 GAACCCTTTGGAACCCCTACAGG + Intronic
1132896855 16:2233316-2233338 GACCCCCATGGCGCTCCCACTGG - Intronic
1136278466 16:29192941-29192963 CACCCCATAGGAAGCCCCACTGG - Intergenic
1137468486 16:48732870-48732892 GAGCCCCAGGGAGCCCCCACAGG - Intergenic
1137469292 16:48740302-48740324 GAGCCCCAGGGAGCCCCCACAGG - Intergenic
1142082848 16:88158974-88158996 CACCCCATAGGAAGCCCCACTGG - Intergenic
1142266829 16:89067805-89067827 GACCCCCAGGGATCCCCCCCAGG - Intergenic
1143175520 17:4952816-4952838 GATACCCGTGGAAGCCCCACTGG - Exonic
1144710861 17:17400729-17400751 GAGCCCCTTGGAGCCCCCGCTGG - Intergenic
1147722944 17:42549947-42549969 GCCCCCCTGGGACCCTCCACTGG - Exonic
1147724155 17:42556174-42556196 GCCCCCCTGGGACCCTCCACTGG - Intergenic
1153794729 18:8610929-8610951 GACAGCCTTGGAACTACCACTGG - Intronic
1155366830 18:25057217-25057239 GACCCTCTAGGGACCCCCACAGG - Intergenic
1157581525 18:48776710-48776732 GACCTCCTTGCAACCTTCACAGG - Intronic
1159190440 18:65034913-65034935 GCCCCGATTGGCACCCCCACAGG + Intergenic
1163496161 19:17647725-17647747 GCACCCCTTGGAGTCCCCACTGG + Intronic
1166745220 19:45138638-45138660 GCCCCCCTTGACACCCACACCGG - Intronic
926483939 2:13432278-13432300 CACCCCCATGGAATCCCCACTGG - Intergenic
933052034 2:77612133-77612155 CACTGGCTTGGAACCCCCACTGG + Intergenic
933773680 2:85759109-85759131 GACCCCCTGGGAAGCTCCAGGGG - Intronic
933897608 2:86825448-86825470 GACCCCATTTGAATCCCCAAGGG + Intronic
934536526 2:95138984-95139006 GAGCCCCTTTGAACCCCAGCTGG - Intronic
937900182 2:127013998-127014020 GCCCACCGTGGAGCCCCCACAGG + Intergenic
946026178 2:216673231-216673253 GGCCTCCATGGTACCCCCACAGG - Exonic
948681389 2:239637349-239637371 GACCCCCTGGGAACCACAAGAGG - Intergenic
948804505 2:240447647-240447669 GACCCCCTTTGACCCCCAGCAGG - Intronic
1171366875 20:24631030-24631052 GACACCCTTGGATTGCCCACAGG + Intronic
1174017754 20:47502259-47502281 GACCCCCTCGGATCCCCAAGCGG - Intronic
1176872276 21:14093285-14093307 CACCCCCCTGGAACTCTCACTGG + Intergenic
952853024 3:37744511-37744533 GAGCCCCTGTGAGCCCCCACGGG + Intronic
964760750 3:160133308-160133330 GTCCCCCCTGTAACCCCAACAGG + Intergenic
968532420 4:1099844-1099866 GAGCCCCGTGGATCCCGCACAGG - Intronic
969896001 4:10305302-10305324 GACCCCCAGGGAAGCCCCACTGG + Intergenic
971576438 4:28280751-28280773 CACTCCCTTGCTACCCCCACTGG + Intergenic
974174916 4:58309634-58309656 TAACCTCTGGGAACCCCCACTGG + Intergenic
982982801 4:162162909-162162931 CATCCCCTTGCAACCCCCTCAGG - Intronic
984870194 4:184318412-184318434 GACCCCCATGGGACCCCCACGGG - Intergenic
997677510 5:135724372-135724394 TACCTCCTTGGAGCCCCCTCAGG + Intergenic
998022218 5:138779236-138779258 GACCATCTTGCAACCCCCACTGG - Intronic
1002838221 6:883528-883550 GGTCCACTAGGAACCCCCACAGG + Intergenic
1004473302 6:15947955-15947977 GCCCTCCTTGGGACCCCCAGTGG - Intergenic
1004811804 6:19270822-19270844 CGCCCACCTGGAACCCCCACCGG - Intergenic
1006187540 6:32189784-32189806 GACCCCCCCGCTACCCCCACCGG + Exonic
1007628533 6:43259884-43259906 GACCTCTCTGGATCCCCCACTGG - Intronic
1009407318 6:63327967-63327989 TAACCTCTGGGAACCCCCACTGG - Intergenic
1014287523 6:119517418-119517440 TCTCCCCTTGGAAGCCCCACAGG - Intergenic
1019538040 7:1538972-1538994 CACCCCCTGGGAAGCCCCTCAGG + Intronic
1027320739 7:77008379-77008401 GAACCCCTAGGAAGCCCCCCTGG - Intergenic
1027775846 7:82463337-82463359 GACCCCCACCCAACCCCCACTGG - Intergenic
1030113279 7:106044295-106044317 GACCCCCTCAAAAGCCCCACTGG + Intergenic
1033791328 7:144795660-144795682 GACCTCCCTGGAGCCCCCAATGG + Intronic
1034531912 7:151701112-151701134 GCCCCCCAGGGAAGCCCCACTGG + Intronic
1043048101 8:75352686-75352708 CACCCCCTTGCCACCTCCACTGG + Intergenic
1047669069 8:127125093-127125115 TAGCCCCTTGGAACTCCCAGTGG - Intergenic
1049341986 8:142118122-142118144 GTCCCCCCTGCACCCCCCACCGG + Intergenic
1049510700 8:143025417-143025439 GACCCCCTCGGACCCGCCCCAGG + Intergenic
1049511436 8:143028689-143028711 GACCCCCTTGGTCCCACCCCAGG + Intergenic
1054809594 9:69424549-69424571 GACCCCCTGGGTACACCAACGGG - Intergenic
1056025949 9:82495703-82495725 AACCCCCTTGCCACCTCCACTGG - Intergenic
1056193524 9:84207287-84207309 GACCCCCCGGGAGCCACCACCGG + Intergenic
1061370014 9:130192833-130192855 GACCCCAGTGGGAACCCCACAGG + Intronic
1197034604 X:121859024-121859046 CACTCCCTTGCTACCCCCACTGG - Intergenic
1199500650 X:148501847-148501869 GACCCCCTTCGGCCTCCCACTGG + Intronic
1199673521 X:150165984-150166006 GGCCCCCTTGGAACCCCAGCTGG + Intergenic