ID: 1077259915

View in Genome Browser
Species Human (GRCh38)
Location 11:1611169-1611191
Sequence AGCCGCTGGCTGGTACTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077259915_1077259920 1 Left 1077259915 11:1611169-1611191 CCTGTCAGTACCAGCCAGCGGCT No data
Right 1077259920 11:1611193-1611215 TTCAAATGTGAGGCATCGGATGG No data
1077259915_1077259921 2 Left 1077259915 11:1611169-1611191 CCTGTCAGTACCAGCCAGCGGCT No data
Right 1077259921 11:1611194-1611216 TCAAATGTGAGGCATCGGATGGG No data
1077259915_1077259919 -3 Left 1077259915 11:1611169-1611191 CCTGTCAGTACCAGCCAGCGGCT No data
Right 1077259919 11:1611189-1611211 GCTTTTCAAATGTGAGGCATCGG No data
1077259915_1077259918 -9 Left 1077259915 11:1611169-1611191 CCTGTCAGTACCAGCCAGCGGCT No data
Right 1077259918 11:1611183-1611205 CCAGCGGCTTTTCAAATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077259915 Original CRISPR AGCCGCTGGCTGGTACTGAC AGG (reversed) Intergenic
No off target data available for this crispr