ID: 1077262568

View in Genome Browser
Species Human (GRCh38)
Location 11:1630534-1630556
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 6, 1: 2, 2: 2, 3: 3, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077262562_1077262568 12 Left 1077262562 11:1630499-1630521 CCTGCTGCTGCCAGTCCAGCTGC 0: 6
1: 9
2: 43
3: 149
4: 696
Right 1077262568 11:1630534-1630556 TGCTGCCAGTGTAAGATCTGAGG 0: 6
1: 2
2: 2
3: 3
4: 144
1077262563_1077262568 2 Left 1077262563 11:1630509-1630531 CCAGTCCAGCTGCTGTGTCCCCG 0: 4
1: 2
2: 9
3: 14
4: 254
Right 1077262568 11:1630534-1630556 TGCTGCCAGTGTAAGATCTGAGG 0: 6
1: 2
2: 2
3: 3
4: 144
1077262560_1077262568 27 Left 1077262560 11:1630484-1630506 CCAGCTGCTACAAGCCCTGCTGC 0: 1
1: 9
2: 21
3: 60
4: 400
Right 1077262568 11:1630534-1630556 TGCTGCCAGTGTAAGATCTGAGG 0: 6
1: 2
2: 2
3: 3
4: 144
1077262564_1077262568 -3 Left 1077262564 11:1630514-1630536 CCAGCTGCTGTGTCCCCGTGTGC 0: 5
1: 1
2: 6
3: 35
4: 227
Right 1077262568 11:1630534-1630556 TGCTGCCAGTGTAAGATCTGAGG 0: 6
1: 2
2: 2
3: 3
4: 144
1077262561_1077262568 13 Left 1077262561 11:1630498-1630520 CCCTGCTGCTGCCAGTCCAGCTG 0: 5
1: 8
2: 17
3: 53
4: 495
Right 1077262568 11:1630534-1630556 TGCTGCCAGTGTAAGATCTGAGG 0: 6
1: 2
2: 2
3: 3
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900847245 1:5113795-5113817 AGCTGACTTTGTAAGATCTGAGG - Intergenic
902129659 1:14248669-14248691 TGCTACCTGTGTCATATCTGAGG + Intergenic
902810613 1:18885879-18885901 TGGAGCCAGTGTAACAGCTGCGG - Intronic
903409696 1:23131279-23131301 AGCTGCCATGGGAAGATCTGAGG - Intronic
903667013 1:25014220-25014242 TGCTGCCACTCCAAGATTTGGGG - Intergenic
904460883 1:30679251-30679273 TGCAGCCAGTGTAATAGCAGTGG - Intergenic
906651798 1:47518013-47518035 TGTTGCCAGAGTAAGATGGGAGG - Intergenic
906914108 1:49989841-49989863 TACAGCTACTGTAAGATCTGTGG - Intronic
908156870 1:61362391-61362413 TGCTTCCTGTGTCACATCTGAGG - Intronic
909475889 1:76080491-76080513 TGGGGCCAATTTAAGATCTGGGG + Intronic
909899085 1:81110129-81110151 TGCTGCCAGAGAGTGATCTGGGG - Intergenic
912508581 1:110173260-110173282 TGGCGCCAGTGTGAGAGCTGAGG - Intronic
912516205 1:110217979-110218001 CACTGGCAGAGTAAGATCTGTGG - Intronic
914863554 1:151406364-151406386 AGCTGCCACTGTGAAATCTGCGG - Exonic
915039025 1:152952236-152952258 TCCTACCAGGGTAAGATGTGGGG + Intergenic
918232295 1:182547561-182547583 TGCTGCCAGTGGAACATTTTAGG - Intronic
920843576 1:209575248-209575270 TGCTTCCAGAGCAAGGTCTGTGG - Intergenic
920951576 1:210576020-210576042 TGCAGCCAGTGTTAGGTGTGTGG + Intronic
923806249 1:237261344-237261366 TGATGTCAGTGTAAGACCTTTGG - Intronic
1065479512 10:26178110-26178132 TGCTGGCAGGGTAGGAGCTGAGG + Intronic
1065919863 10:30383654-30383676 TGCTGACAGTGTAAGTTGTTAGG + Intergenic
1066048592 10:31615899-31615921 TGCTTCCTGTTTAAGAACTGGGG + Intergenic
1070700410 10:78597885-78597907 TCCTGCCTGTGGAAGGTCTGCGG + Intergenic
1074430673 10:113391529-113391551 AGCTGCCAATGTATGATTTGGGG - Intergenic
1075473019 10:122707664-122707686 TGCTGCCTGTGAAGGATCAGAGG - Intergenic
1077257994 11:1597715-1597737 TGCTGCCAGTGTAAGATCTGAGG - Exonic
1077259374 11:1607667-1607689 TGCTGCCAGTGCAAGATCTGAGG - Exonic
1077261091 11:1621405-1621427 TGCTGCCAGTGTAAGATCTGAGG - Exonic
1077262568 11:1630534-1630556 TGCTGCCAGTGTAAGATCTGAGG + Exonic
1077274516 11:1697615-1697637 TGCTGCCAGTGCAAAATCTGAGG + Exonic
1084031646 11:66484704-66484726 TGTTACCAGAGGAAGATCTGGGG + Intronic
1084368853 11:68724443-68724465 TGCTGCCACTGTAGGATAAGGGG - Intronic
1084798850 11:71527778-71527800 TGCTGCCAGTGTAAGATCTGAGG + Exonic
1084800196 11:71538599-71538621 TGCTGCCAGTGCAAGATCTGAGG + Exonic
1084801841 11:71549147-71549169 TGCTACCAGTGCAAGATCTGAGG + Exonic
1084803992 11:71566176-71566198 TGCTGCCAGTGTAAGATCTGAGG + Exonic
1084806425 11:71582365-71582387 TGCTGCCAGTGTAAGATCTGAGG - Exonic
1087375125 11:97330083-97330105 TACTGCCAGTGTGAAAGCTGGGG + Intergenic
1090617276 11:128526640-128526662 GGTTGCCAGTTTAAGAACTGAGG - Intronic
1092598340 12:10031842-10031864 TGCTGTCAGTGAAGGCTCTGAGG + Intronic
1094164276 12:27426126-27426148 TGCTGGCAGTGGGAGACCTGGGG - Intergenic
1095853453 12:46834789-46834811 TACAGCCAGTGAATGATCTGAGG - Intergenic
1099948270 12:89270494-89270516 TGCTGCCTGTCTAATATCTATGG - Intergenic
1100876659 12:98969033-98969055 TGCTGCCAGAGAATGTTCTGGGG - Intronic
1103150879 12:118637570-118637592 TGCTGCCAGAGGAAGCTCTTGGG - Intergenic
1104278383 12:127351774-127351796 CGCTGCCAGCGTCAGACCTGGGG - Intergenic
1107985061 13:45768490-45768512 TGCTGCCTGAGTGAGGTCTGGGG - Intergenic
1113608348 13:111626244-111626266 TGCTGCCAGTGTGGGAGCTGTGG - Intronic
1119650670 14:76380815-76380837 TGCTGCCAGTGCAGGGTCTAAGG + Intronic
1122059420 14:99126592-99126614 GGCTGCCAGTGTAGGCCCTGAGG + Intergenic
1122327898 14:100893431-100893453 TGCAGCCAAGGTAAGATGTGGGG - Intergenic
1125591311 15:40856187-40856209 GGATGCCAGTGTGAGGTCTGGGG + Intronic
1133465241 16:6021009-6021031 TGCTGGCACTGGAACATCTGGGG + Intronic
1135648677 16:24186588-24186610 GGCTGCCAGTCCTAGATCTGTGG + Intronic
1135710641 16:24714037-24714059 TGCTGACATTGTTGGATCTGTGG + Intergenic
1136411290 16:30078930-30078952 TGCTGCAAGTGGCAGAACTGGGG + Intronic
1140335372 16:74099958-74099980 TGGTGACAGTATAAGATCAGTGG + Intergenic
1144668970 17:17120804-17120826 TGCTGACAGCGTTAGAGCTGAGG + Intronic
1147138492 17:38448616-38448638 TGCTGCCACTGAAAGAACTTGGG + Intronic
1148291626 17:46456476-46456498 TGCTGCCAGTTAAAGGTCTCTGG - Intergenic
1148313816 17:46674183-46674205 TGCTGCCAGTTAAAGGTCTCTGG - Intronic
1148547454 17:48529020-48529042 TGGTGCTATTGTAAGGTCTGTGG + Exonic
1150605140 17:66684395-66684417 TGCTCAGAGTGTAGGATCTGGGG - Intronic
1151386822 17:73760164-73760186 TGCTGCCTCTGTAAGGTCTGGGG + Intergenic
1152639676 17:81444366-81444388 TGCTGTCCCTGTAAGACCTGGGG - Exonic
1154383211 18:13870923-13870945 TGCTGCAAGTGTGAGGTCTCTGG + Intergenic
1157864174 18:51166695-51166717 TGATGCCAGAGTAACAACTGGGG - Intergenic
1157903356 18:51542518-51542540 TGCTGAGAGTGTAATGTCTGAGG + Intergenic
1165093022 19:33396484-33396506 TGCTGCCAATGTGAGGTCAGAGG - Intronic
1168060366 19:53888777-53888799 AGCTGCCAGTGAAGGAGCTGGGG + Intronic
928098686 2:28422199-28422221 TGATGCCAGTGTTAGAAATGAGG + Intergenic
928108900 2:28490652-28490674 TGCTGCCAGTCTCACAGCTGAGG + Intronic
928284870 2:29981218-29981240 TGCTGACACTGGAAGATCTCAGG - Intergenic
930009086 2:46921862-46921884 TCCTGTCAGTGTCAGATCAGCGG - Intronic
932169128 2:69537818-69537840 GGCATCGAGTGTAAGATCTGGGG + Intronic
933643084 2:84785165-84785187 TGCTGGAAGTTTATGATCTGTGG + Intronic
933652518 2:84860862-84860884 TTCTGCCAGTGGGTGATCTGGGG - Intronic
933995959 2:87670003-87670025 CTCTGCCAGTGTAAATTCTGGGG + Intergenic
936297898 2:111280909-111280931 CTCTGCCAGTGTAAATTCTGGGG - Intergenic
945785525 2:214230972-214230994 TGCTTCCAATTTAAGATCTTTGG - Intronic
948463702 2:238142364-238142386 TCCTGGCAGTGGGAGATCTGGGG + Intronic
1169044831 20:2526936-2526958 GGCTGCCAGTGTGGGAGCTGAGG - Intergenic
1169385994 20:5150152-5150174 TGCTGCCACTGTGATAACTGAGG + Intronic
1171424688 20:25042238-25042260 TGCTGCCACTGGAATATTTGGGG - Intronic
1173159773 20:40643929-40643951 TGCTGCCAGTCTCAGCTCCGGGG + Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175892340 20:62321334-62321356 TGCAGCCAGTGGAAGAGGTGGGG + Intronic
1175892447 20:62321636-62321658 TGCAGCCAGTGGAAGAGGTGGGG + Intronic
1176710891 21:10148097-10148119 TCCTGCCAGGGTAAGAGCAGAGG - Intergenic
1182029752 22:27148706-27148728 AGCTGGAAGTGTAAGATCAGGGG - Intergenic
1182127898 22:27829486-27829508 GGCTGCCATTGACAGATCTGGGG + Intergenic
1184227025 22:43134961-43134983 TGCTTTCCGTGTAAGATCTCTGG + Intronic
1184974616 22:48052166-48052188 TGCCCCCAGTGTGTGATCTGAGG - Intergenic
950292387 3:11795822-11795844 TGTTGCCAGTTTGAGATGTGAGG + Intronic
954806861 3:53225592-53225614 TGCAGCCAGTGCAGGTTCTGGGG - Intronic
956681877 3:71788481-71788503 TGCTCCCTGTGAAGGATCTGGGG - Intergenic
965314267 3:167171648-167171670 TGCTACCAGCCTAACATCTGGGG - Intergenic
966982363 3:185149772-185149794 TGCTGCCAGTGGAGGAAGTGTGG + Intronic
969185848 4:5473733-5473755 TGCTGCCATTGTGTGGTCTGAGG - Intronic
969218532 4:5743592-5743614 TCCTACCACTGTGAGATCTGGGG + Intronic
969677289 4:8621078-8621100 TTGTGCCAGTGTAAGACTTGAGG - Intergenic
969678241 4:8626716-8626738 TTGTGCCAGTGTAAGACTTGAGG - Intergenic
969679197 4:8632354-8632376 TTGTGCCAGTGTAAGACTTGAGG - Intergenic
971298867 4:25425577-25425599 TGCTGCCCGTGTAATTCCTGTGG - Intergenic
974405912 4:61469130-61469152 TACTGCCCTTCTAAGATCTGAGG - Intronic
974441440 4:61923524-61923546 TCCTGGCAGTGTAGGATCCGAGG - Intronic
977028441 4:91851650-91851672 GGCTGCCAGTGAAAGAACTCTGG - Intergenic
984511368 4:180682950-180682972 TGCTGGGTGTGTAAGATATGAGG + Intergenic
985261402 4:188118222-188118244 TGCTGCTGGTGTAAGTCCTGGGG + Intergenic
986909112 5:12532541-12532563 TGCTGGTAGTGCAAGAGCTGTGG - Intergenic
990028083 5:51220772-51220794 TGCTGCCAGTATAGGATTTAAGG - Intergenic
990607409 5:57424104-57424126 TCATACCAGTGTGAGATCTGTGG + Intergenic
990865592 5:60376397-60376419 TGCTGGGAGTGTGAGCTCTGGGG - Intronic
992420013 5:76594237-76594259 TGTTGCCAGTGAGACATCTGAGG + Intronic
996550712 5:124727103-124727125 TGCTGTCACTGTAAGACCTTTGG - Intronic
997813989 5:136998759-136998781 TGCTGCCTGTGTCACATGTGTGG + Intronic
998643419 5:144037396-144037418 GGCTGGCAGTGTAGGATCTCAGG + Intergenic
1001050129 5:168407437-168407459 ATCTGCCAGTGAAATATCTGAGG - Intronic
1001708308 5:173758107-173758129 GGCTGCAGGTGGAAGATCTGGGG + Intergenic
1002904501 6:1437960-1437982 GGCTGCCAGTGTCAGAGCTCGGG + Intergenic
1003503821 6:6724274-6724296 GGCTGCCAGTGGAAAGTCTGAGG + Intergenic
1004322755 6:14645554-14645576 TGTAGCCAGTGTAATTTCTGTGG - Intergenic
1005430776 6:25754465-25754487 TGCTGTCAGTGAAACATGTGGGG + Intergenic
1017586770 6:155935451-155935473 TGTTGCCTATGTTAGATCTGTGG - Intergenic
1018543133 6:164905289-164905311 TGCTGCCGGGGTAAGTTGTGGGG - Intergenic
1019737771 7:2659103-2659125 TGCAGCCAGTGTGAGCTCTGGGG + Intronic
1020379755 7:7530324-7530346 TGCTTTCAGCATAAGATCTGAGG - Intronic
1021267566 7:18543989-18544011 TGAGGCCACTGTAAGATCTTTGG + Intronic
1025148474 7:56525580-56525602 TGCTGCAAGTGTAAAAAATGAGG - Intergenic
1026106363 7:67424073-67424095 TCCTGCCAGGGTGGGATCTGGGG - Intergenic
1028469997 7:91195711-91195733 AGCTGCCACTGTAAAGTCTGTGG - Intronic
1032901212 7:136310659-136310681 TGCTGCCCGTGGAAGGTCAGTGG - Intergenic
1033201773 7:139379148-139379170 TGCTGCAAGTGACAGATCTTAGG - Intronic
1036178535 8:6563224-6563246 TACTGACACTGTAGGATCTGGGG - Exonic
1041635004 8:60133021-60133043 TGCTGTCAGTGTAAGCTGTCTGG - Intergenic
1043331927 8:79127934-79127956 TGCTGGCACTGTAAGTACTGGGG - Intergenic
1045482543 8:102603643-102603665 TAGTGACAGTGTAAGAGCTGAGG + Intergenic
1045848799 8:106668930-106668952 TACTGTGAATGTAAGATCTGAGG - Intronic
1047815636 8:128459682-128459704 TGCTGCCACTGTGTGATGTGGGG + Intergenic
1051707419 9:19895426-19895448 TGCTGGCATTGTCAGTTCTGAGG + Intergenic
1053647874 9:40133793-40133815 TCCTGCCAGGGTAAGAGCAGAGG - Intergenic
1053757858 9:41330053-41330075 TCCTGCCAGGGTAAGAGCAGAGG + Intergenic
1054328848 9:63731745-63731767 TCCTGCCAGGGTAAGAGCAGAGG - Intergenic
1054536706 9:66242377-66242399 TCCTGCCAGGGTAAGAGCAGAGG + Intergenic
1055149764 9:72982420-72982442 TGCTCTCACTGTAAGATTTGTGG - Intronic
1056809840 9:89755742-89755764 TGCTGCCAGTGTTATCTTTGGGG - Intergenic
1059235541 9:112757896-112757918 TGCTGCCAATGTAAGTTCACAGG + Intronic
1202795649 9_KI270719v1_random:117085-117107 TCCTGCCAGGGTAAGAGCAGAGG - Intergenic
1185480578 X:443493-443515 TGCTTCCTCTGCAAGATCTGGGG - Intergenic
1193741361 X:85220997-85221019 TGAGGCAAGTGTAAGATATGGGG - Intergenic
1194212026 X:91081806-91081828 TGCACCCAGGGCAAGATCTGCGG - Intergenic
1194748501 X:97656932-97656954 AGCAGCCCCTGTAAGATCTGAGG + Intergenic
1195154936 X:102113547-102113569 TGCTGCCAGGGAGAGAGCTGGGG - Intergenic
1196137205 X:112222860-112222882 TGTTGCCAGTGAAAGAAGTGTGG + Intergenic
1197990495 X:132312023-132312045 TGCTGCCCAAGTAAGCTCTGTGG - Intergenic
1200100158 X:153686159-153686181 TGCTGCCTTTGTGAGATCAGAGG - Intronic
1200730050 Y:6724958-6724980 TGATGCCAGTCTAACATTTGAGG + Intergenic