ID: 1077265508

View in Genome Browser
Species Human (GRCh38)
Location 11:1647088-1647110
Sequence GAAAATGCAAAGAACCGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077265508_1077265516 22 Left 1077265508 11:1647088-1647110 CCCAGCCGGTTCTTTGCATTTTC No data
Right 1077265516 11:1647133-1647155 TGCTGAGACCTGGCACGGATGGG No data
1077265508_1077265515 21 Left 1077265508 11:1647088-1647110 CCCAGCCGGTTCTTTGCATTTTC No data
Right 1077265515 11:1647132-1647154 GTGCTGAGACCTGGCACGGATGG No data
1077265508_1077265512 12 Left 1077265508 11:1647088-1647110 CCCAGCCGGTTCTTTGCATTTTC No data
Right 1077265512 11:1647123-1647145 CAGACCTGTGTGCTGAGACCTGG No data
1077265508_1077265514 17 Left 1077265508 11:1647088-1647110 CCCAGCCGGTTCTTTGCATTTTC No data
Right 1077265514 11:1647128-1647150 CTGTGTGCTGAGACCTGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077265508 Original CRISPR GAAAATGCAAAGAACCGGCT GGG (reversed) Intergenic
No off target data available for this crispr