ID: 1077268220

View in Genome Browser
Species Human (GRCh38)
Location 11:1662517-1662539
Sequence CTGTTATTCTTCACTACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077268220_1077268222 29 Left 1077268220 11:1662517-1662539 CCTTTTGTAGTGAAGAATAACAG No data
Right 1077268222 11:1662569-1662591 ATGGCCAAACACATCCAAGCTGG No data
1077268220_1077268223 30 Left 1077268220 11:1662517-1662539 CCTTTTGTAGTGAAGAATAACAG No data
Right 1077268223 11:1662570-1662592 TGGCCAAACACATCCAAGCTGGG No data
1077268220_1077268221 10 Left 1077268220 11:1662517-1662539 CCTTTTGTAGTGAAGAATAACAG No data
Right 1077268221 11:1662550-1662572 AATAGCAGAAAAGAAGCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077268220 Original CRISPR CTGTTATTCTTCACTACAAA AGG (reversed) Intergenic
No off target data available for this crispr