ID: 1077268780

View in Genome Browser
Species Human (GRCh38)
Location 11:1665559-1665581
Sequence GCAGGTAGCGTGGCTGCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077268768_1077268780 22 Left 1077268768 11:1665514-1665536 CCAGGTGTCAGGCTTGGCAGGAG No data
Right 1077268780 11:1665559-1665581 GCAGGTAGCGTGGCTGCCGGAGG No data
1077268767_1077268780 23 Left 1077268767 11:1665513-1665535 CCCAGGTGTCAGGCTTGGCAGGA No data
Right 1077268780 11:1665559-1665581 GCAGGTAGCGTGGCTGCCGGAGG No data
1077268765_1077268780 24 Left 1077268765 11:1665512-1665534 CCCCAGGTGTCAGGCTTGGCAGG No data
Right 1077268780 11:1665559-1665581 GCAGGTAGCGTGGCTGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077268780 Original CRISPR GCAGGTAGCGTGGCTGCCGG AGG Intergenic