ID: 1077271514

View in Genome Browser
Species Human (GRCh38)
Location 11:1684264-1684286
Sequence CAGTGGACTCATCAGGATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077271504_1077271514 8 Left 1077271504 11:1684233-1684255 CCTTCTCCATCCCTGAAAACCAT No data
Right 1077271514 11:1684264-1684286 CAGTGGACTCATCAGGATGCCGG No data
1077271510_1077271514 -3 Left 1077271510 11:1684244-1684266 CCTGAAAACCATCGCGGGGACAG No data
Right 1077271514 11:1684264-1684286 CAGTGGACTCATCAGGATGCCGG No data
1077271506_1077271514 2 Left 1077271506 11:1684239-1684261 CCATCCCTGAAAACCATCGCGGG No data
Right 1077271514 11:1684264-1684286 CAGTGGACTCATCAGGATGCCGG No data
1077271509_1077271514 -2 Left 1077271509 11:1684243-1684265 CCCTGAAAACCATCGCGGGGACA No data
Right 1077271514 11:1684264-1684286 CAGTGGACTCATCAGGATGCCGG No data
1077271503_1077271514 26 Left 1077271503 11:1684215-1684237 CCAGCGGAGGACAGGGAGCCTTC No data
Right 1077271514 11:1684264-1684286 CAGTGGACTCATCAGGATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077271514 Original CRISPR CAGTGGACTCATCAGGATGC CGG Intergenic
No off target data available for this crispr