ID: 1077272662

View in Genome Browser
Species Human (GRCh38)
Location 11:1689101-1689123
Sequence CTGTTATTCTTCACTACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077272661_1077272662 10 Left 1077272661 11:1689068-1689090 CCATTAGCTTCTTTTCTGCTATT No data
Right 1077272662 11:1689101-1689123 CTGTTATTCTTCACTACAAAAGG No data
1077272659_1077272662 30 Left 1077272659 11:1689048-1689070 CCCAGCTTGGATGTGTTTGGCCA No data
Right 1077272662 11:1689101-1689123 CTGTTATTCTTCACTACAAAAGG No data
1077272660_1077272662 29 Left 1077272660 11:1689049-1689071 CCAGCTTGGATGTGTTTGGCCAT No data
Right 1077272662 11:1689101-1689123 CTGTTATTCTTCACTACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077272662 Original CRISPR CTGTTATTCTTCACTACAAA AGG Intergenic
No off target data available for this crispr