ID: 1077273690

View in Genome Browser
Species Human (GRCh38)
Location 11:1693665-1693687
Sequence GCCACTGGGGGCAAAGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077273690_1077273712 21 Left 1077273690 11:1693665-1693687 CCCCCCTCTTTGCCCCCAGTGGC No data
Right 1077273712 11:1693709-1693731 ACCTAGAGCCTGGGGACCAGGGG No data
1077273690_1077273706 12 Left 1077273690 11:1693665-1693687 CCCCCCTCTTTGCCCCCAGTGGC No data
Right 1077273706 11:1693700-1693722 GTTGCCACCACCTAGAGCCTGGG No data
1077273690_1077273705 11 Left 1077273690 11:1693665-1693687 CCCCCCTCTTTGCCCCCAGTGGC No data
Right 1077273705 11:1693699-1693721 GGTTGCCACCACCTAGAGCCTGG No data
1077273690_1077273699 -10 Left 1077273690 11:1693665-1693687 CCCCCCTCTTTGCCCCCAGTGGC No data
Right 1077273699 11:1693678-1693700 CCCCAGTGGCCCCGAGCGAGGGG No data
1077273690_1077273707 13 Left 1077273690 11:1693665-1693687 CCCCCCTCTTTGCCCCCAGTGGC No data
Right 1077273707 11:1693701-1693723 TTGCCACCACCTAGAGCCTGGGG No data
1077273690_1077273710 19 Left 1077273690 11:1693665-1693687 CCCCCCTCTTTGCCCCCAGTGGC No data
Right 1077273710 11:1693707-1693729 CCACCTAGAGCCTGGGGACCAGG No data
1077273690_1077273711 20 Left 1077273690 11:1693665-1693687 CCCCCCTCTTTGCCCCCAGTGGC No data
Right 1077273711 11:1693708-1693730 CACCTAGAGCCTGGGGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077273690 Original CRISPR GCCACTGGGGGCAAAGAGGG GGG (reversed) Intergenic
No off target data available for this crispr