ID: 1077278894

View in Genome Browser
Species Human (GRCh38)
Location 11:1733082-1733104
Sequence GGACAAGCCTGGGCTGGAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 1, 2: 6, 3: 32, 4: 387}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077278894_1077278902 -1 Left 1077278894 11:1733082-1733104 CCTCTTCCAGCCCAGGCTTGTCC 0: 1
1: 1
2: 6
3: 32
4: 387
Right 1077278902 11:1733104-1733126 CAGGAAGCCTCTGGGTCTAATGG 0: 1
1: 0
2: 1
3: 24
4: 205
1077278894_1077278900 -9 Left 1077278894 11:1733082-1733104 CCTCTTCCAGCCCAGGCTTGTCC 0: 1
1: 1
2: 6
3: 32
4: 387
Right 1077278900 11:1733096-1733118 GGCTTGTCCAGGAAGCCTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 199
1077278894_1077278904 28 Left 1077278894 11:1733082-1733104 CCTCTTCCAGCCCAGGCTTGTCC 0: 1
1: 1
2: 6
3: 32
4: 387
Right 1077278904 11:1733133-1733155 CATCCGAAGTGCCCACAACCAGG 0: 1
1: 0
2: 0
3: 3
4: 55
1077278894_1077278899 -10 Left 1077278894 11:1733082-1733104 CCTCTTCCAGCCCAGGCTTGTCC 0: 1
1: 1
2: 6
3: 32
4: 387
Right 1077278899 11:1733095-1733117 AGGCTTGTCCAGGAAGCCTCTGG 0: 1
1: 0
2: 0
3: 16
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077278894 Original CRISPR GGACAAGCCTGGGCTGGAAG AGG (reversed) Exonic
900380611 1:2382091-2382113 GGACAGGGCTAGGCTGGGAGTGG + Intronic
900506995 1:3034715-3034737 GGACAAGCCTGGAGTGGAGAGGG + Intergenic
901402622 1:9025150-9025172 CCTCCAGCCTGGGCTGGAAGTGG + Intronic
902302974 1:15515909-15515931 GGCCAGGCATGGGCTGGGAGTGG + Intronic
902567013 1:17318249-17318271 GCACCAGGCTGGGCTGCAAGAGG + Intronic
902918112 1:19650959-19650981 AGCCAAGGCTGGGCTGGAACAGG - Intronic
903203123 1:21759619-21759641 GCACAAGAGTTGGCTGGAAGGGG + Intronic
903365733 1:22804627-22804649 AGAGAAGCCTGACCTGGAAGGGG - Intronic
903692426 1:25183900-25183922 GGACAGGCCTGGGCTGGAGCAGG - Intergenic
903779899 1:25814481-25814503 GGCCAGTCCTGGGATGGAAGGGG + Intronic
904002866 1:27348808-27348830 GGACTGGCCTGGCCTGGCAGAGG + Intronic
904413238 1:30337644-30337666 GGAAAAGCCTTGGCTGGGAAGGG - Intergenic
904923695 1:34029149-34029171 GGGGCAGCCTAGGCTGGAAGTGG + Intronic
905016343 1:34781371-34781393 GGACCGGGCTGGGCCGGAAGCGG + Exonic
905806524 1:40881394-40881416 GGGAAAGCCAAGGCTGGAAGTGG - Intergenic
909884385 1:80922743-80922765 GGAGAAGTCTTGGCTGGAAAGGG - Intergenic
913250678 1:116910120-116910142 GGAGCAGCCGGAGCTGGAAGAGG + Exonic
913321877 1:117594368-117594390 GGACAAGGCTGCCCTGGAAGAGG - Intergenic
914904836 1:151735326-151735348 AAACAAGGCTGGGCTGGGAGTGG + Intergenic
915043257 1:152985973-152985995 GGACACTCCTGGGCTGGAAGTGG + Intergenic
915490596 1:156248070-156248092 GGCCAGGCCTGGGCGGGGAGTGG + Intronic
915931917 1:160066000-160066022 GGGCAAACCTGGGCCGGGAGAGG + Intronic
916489299 1:165287444-165287466 TGACAAGACTGGGCTGGAATTGG + Intronic
916871379 1:168918277-168918299 GGAGAAGCAAGGGCAGGAAGAGG - Intergenic
916873224 1:168939902-168939924 AGTCAAGCCTGAGCTGCAAGTGG + Intergenic
917642336 1:176995450-176995472 AGATAAGCCTGGGATGGCAGAGG + Intronic
918096853 1:181343168-181343190 GGAGAAGACTGGGGTGGAGGAGG + Intergenic
919428220 1:197460498-197460520 GCACAACCCTTGGCTGAAAGAGG - Intronic
919829713 1:201531788-201531810 GGACAAGCGTGGGCTGGAAGAGG + Intergenic
920218015 1:204375212-204375234 AGAGAGGCCTGGGCTGGAAAAGG - Intronic
920308524 1:205034175-205034197 GGATGAGCCTGAGCTGGCAGAGG - Intergenic
920498779 1:206473337-206473359 GGCCAAGGCTGGGCTGGACAGGG - Intronic
921936853 1:220803594-220803616 GGACAAGCCTGGTATGGGAGAGG - Intronic
922444737 1:225687618-225687640 AGACCAGCCTGGGCTGGGCGCGG + Intergenic
922509374 1:226150665-226150687 GAAAAAGCCTGGGCCGGACGCGG - Intronic
923049592 1:230381520-230381542 GGGTAAGCCTAGGCTGGCAGAGG - Intronic
923092975 1:230753661-230753683 GGAGGGGCCTGGGCTGGAGGTGG - Intronic
923103981 1:230840120-230840142 AGACATGCCTGGGGTTGAAGAGG - Intronic
923462819 1:234221805-234221827 GGAGAAGCCCAGGCTGCAAGAGG - Intronic
1064473334 10:15659847-15659869 GGACCATCAGGGGCTGGAAGGGG + Intronic
1064654954 10:17547642-17547664 GGACTAGCCTTGGCTGGGCGCGG + Intergenic
1064860263 10:19817708-19817730 GGCCAAGCGGGCGCTGGAAGGGG + Intronic
1065114895 10:22476007-22476029 GGAAAAGCATGAGCAGGAAGAGG + Intergenic
1066052071 10:31645085-31645107 GGACCAGCCTTGGCGGGCAGGGG + Intergenic
1067455969 10:46419478-46419500 GGAGAAGCCAAGGCTGGAAAAGG + Intergenic
1067631231 10:47965161-47965183 GGAGAAGCCAAGGCTGGAAAAGG - Intergenic
1069557604 10:69408085-69408107 GGACAAGCTTGGACTGAAGGAGG + Intronic
1069595691 10:69668633-69668655 GGAAAAGCATGGGGTGGAATGGG + Intergenic
1070505793 10:77111601-77111623 AGACAGGCCTGGGATGGCAGTGG - Intronic
1070836308 10:79449038-79449060 GGAGAAACCTGGGCAAGAAGAGG + Intergenic
1071055268 10:81502855-81502877 GGAGAGGCCTGGGCGGGAACCGG + Intergenic
1071564404 10:86664319-86664341 GGACATACCTGGGGAGGAAGGGG + Intronic
1072664963 10:97385936-97385958 GGCCAGGCCTGGCGTGGAAGAGG + Exonic
1072716035 10:97753194-97753216 GGACAGGGCTGGGCTGGTGGGGG + Intronic
1073116243 10:101093508-101093530 GGGCAAGGCTGGGCTGGGACAGG - Intronic
1073180106 10:101578392-101578414 GGAGCAGGCTGGGCTGGCAGAGG - Intronic
1073306101 10:102504359-102504381 GGACAGGCGCGGGCTGGAAAGGG + Intronic
1073792258 10:106952414-106952436 GGACAGGCCTGGGTGGGTAGAGG - Intronic
1074128078 10:110546201-110546223 GAACAAGGCTGGGATGGACGTGG + Intergenic
1074193252 10:111156417-111156439 GGGCAAGCCTGGGAAGGAACAGG - Intergenic
1074237464 10:111600228-111600250 GTACAAGCCTGGGCTGCTGGGGG + Intergenic
1074563364 10:114554050-114554072 GGAGAAGGGTGGGCTGCAAGAGG + Intronic
1075578666 10:123599484-123599506 GGCCCAGGCTGGGCTGGGAGTGG - Intergenic
1075808550 10:125207735-125207757 GCAAAAGAGTGGGCTGGAAGGGG + Intergenic
1076373842 10:129970908-129970930 GTGCACGCCGGGGCTGGAAGGGG + Intergenic
1077039865 11:515341-515363 AGACAAGCCCAGGCTGGCAGAGG - Intergenic
1077242835 11:1519738-1519760 GGATAAGGCTGTGCTGGAAAAGG + Intergenic
1077278894 11:1733082-1733104 GGACAAGCCTGGGCTGGAAGAGG - Exonic
1077467731 11:2741566-2741588 GCTCAGGCCTGGGTTGGAAGAGG - Intronic
1078110036 11:8384995-8385017 GGCCAGGCCTGGGCTGGCAGTGG - Intergenic
1078507691 11:11964905-11964927 GGTCAGGCCTGCGCTGGAGGAGG - Intronic
1079867583 11:25756118-25756140 GGACAGGCATGGGCAGGAACCGG + Intergenic
1080054116 11:27887469-27887491 GGACAAGTGTGACCTGGAAGGGG + Intergenic
1081437334 11:43041204-43041226 CTCCAAGCCTGGGATGGAAGGGG + Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1083319818 11:61838766-61838788 GGACAAGCATGGGCTGGCATGGG - Intronic
1083659619 11:64246103-64246125 GGGCTATCCTGGGCTGGCAGCGG - Intronic
1083898491 11:65632284-65632306 GGACAAGTCAGGGCTGCCAGGGG + Intronic
1084195414 11:67521772-67521794 GGACAAGACTGAGCAGGGAGGGG - Intronic
1084697342 11:70763520-70763542 GGACCAGGCTGGGCTCGCAGTGG + Intronic
1084734723 11:71097210-71097232 GGCTAAGCCAGGGCGGGAAGAGG - Intronic
1085336843 11:75702826-75702848 AGACCAGCCTGGCCAGGAAGTGG + Intergenic
1085392347 11:76188946-76188968 GGCCAGGCCTGAGCCGGAAGGGG + Intronic
1086927154 11:92652797-92652819 GAAGAAGCCAGGGCTGGAAGAGG - Intronic
1089258253 11:117205535-117205557 GGACATGCCTGTCCTGAAAGCGG - Exonic
1089332525 11:117699873-117699895 GGACAAGCCCAGGAGGGAAGTGG - Intronic
1089366340 11:117923227-117923249 CGAGACCCCTGGGCTGGAAGTGG - Intronic
1089615417 11:119692167-119692189 CGACAAGTCTGAGCTGGAAGCGG - Intronic
1089658634 11:119971103-119971125 AGACAAGCCGGGGCTGAAGGAGG + Intergenic
1089757481 11:120697115-120697137 GGAGCAGCCTGGGGTGGAACTGG - Intronic
1091197238 11:133742127-133742149 AGACAAGCCTGGGCAAGATGGGG + Intergenic
1091673001 12:2466664-2466686 GCACAAGCCTGGGTAGGCAGAGG + Intronic
1091706547 12:2697309-2697331 GGACAAGTCTGTGATGGTAGTGG + Intronic
1091727415 12:2855539-2855561 TGAGAATCCTGGGCTGGCAGAGG - Intronic
1092556881 12:9569237-9569259 GTCCTAGCCAGGGCTGGAAGAGG + Intergenic
1093208664 12:16281504-16281526 GAACAAGCCTGGGTTGGAATGGG - Intergenic
1093547147 12:20361620-20361642 GCACCACCCTGGGATGGAAGAGG - Intergenic
1096109378 12:49020115-49020137 GCACAAGCTTGGGCAGAAAGGGG + Exonic
1097021216 12:56021888-56021910 AGACAGGCCTGGGTGGGAAGGGG + Intronic
1097175052 12:57137846-57137868 GGGCAAGGCTGGGCAGGAATGGG - Intronic
1097283666 12:57861505-57861527 AGACCAGCCTGGGCAGCAAGGGG - Intergenic
1101438998 12:104688920-104688942 AGACCAGCCTGGGCAAGAAGGGG + Intronic
1101540392 12:105659684-105659706 TGTCAAGCCTGGGATGGATGTGG - Intergenic
1102747736 12:115264502-115264524 GAACAAGCCTGGGATGTAAAAGG + Intergenic
1103059450 12:117847173-117847195 GGGAAAGGCTGGGCTGGCAGAGG - Intronic
1103446343 12:120997459-120997481 GGCCAGGCCTGGAGTGGAAGGGG - Exonic
1104625579 12:130351426-130351448 AGACAAGTCTAGGCTGGAACTGG - Intronic
1105823033 13:24096788-24096810 GGCCCAGCCTGGGTAGGAAGTGG + Intronic
1106255798 13:28020968-28020990 TTACAAGCCTGGGGTTGAAGGGG + Intronic
1106269494 13:28139126-28139148 GGGCAGGCCTGGGCCGGATGAGG + Intronic
1107907241 13:45072545-45072567 GGGCAGGGCTGGGCTGGGAGAGG - Intergenic
1108404996 13:50091990-50092012 AGAAAGGCCTGGGCTGGAAATGG + Intronic
1113842104 13:113366128-113366150 GGCCAGGCCTGGGCTGGAGCGGG - Intergenic
1114525757 14:23366116-23366138 GGACTCGCCTGGGCTGGGAGTGG + Intergenic
1114608251 14:24015828-24015850 GGAGAAGCATGGGCAGGAACTGG - Intergenic
1114616980 14:24073524-24073546 GGAGAAGACAGGGCTGGAACAGG - Exonic
1114699297 14:24661333-24661355 GGACAAGACTGAGCTGGTTGAGG - Intergenic
1116493322 14:45531983-45532005 GGACACACATGGGCTGAAAGTGG - Intergenic
1116786490 14:49294238-49294260 GGGCAACCCTGGGCTGGGAGTGG + Intergenic
1116840229 14:49813063-49813085 AAACAAGCCTCGGCTGGATGCGG - Intronic
1118049669 14:62013335-62013357 GCAAAGGCATGGGCTGGAAGTGG - Intronic
1118124724 14:62889054-62889076 GGACATTCATGGGCTGGAAGTGG + Intronic
1119195637 14:72715089-72715111 GGCCAAGCATGGGCTGGTGGCGG - Intronic
1119211168 14:72833228-72833250 GGACAAAACTGGGTGGGAAGAGG + Intronic
1119224525 14:72934633-72934655 CCACATGCCTGGGCTGGAGGTGG - Intronic
1121761365 14:96447816-96447838 AGAGCAGCCTGGACTGGAAGAGG - Intronic
1122216568 14:100208519-100208541 GGAGAGGCATGGGCTGGAACCGG - Intergenic
1123019210 14:105389770-105389792 GGCCAGGCCAGGGCTGGCAGTGG + Intronic
1123054158 14:105561332-105561354 GGACAAGCCGGGGCTGGACGGGG - Intergenic
1123078741 14:105681749-105681771 GGACAAGCCGGGGCTGGACGGGG - Intergenic
1124069971 15:26381951-26381973 GGACAAGCCTGGATTGGAAGAGG - Intergenic
1124362845 15:29051451-29051473 GGACAAGCCTGTGCAGGTGGCGG + Intronic
1125427634 15:39565661-39565683 GGAAAATCCTGGGCTGGCAAAGG - Intergenic
1125590959 15:40854222-40854244 GGACGATGCTGGGCTGGAAGGGG - Intronic
1126053276 15:44707027-44707049 CCACAGGCCTGGGGTGGAAGTGG - Intronic
1126465349 15:48956566-48956588 GGGCAGGCCAGGGTTGGAAGAGG - Intronic
1126873015 15:53009874-53009896 GGACAAGGATGTGGTGGAAGAGG + Intergenic
1128526696 15:68417121-68417143 GGGCAGGCCTGGGCTGGGTGGGG - Intronic
1129514426 15:76148395-76148417 GGACAGGACTGGCCTGGAGGCGG - Intronic
1130919795 15:88334514-88334536 AGAACAGCCTGGTCTGGAAGAGG + Intergenic
1131383732 15:91985771-91985793 GGACAAGCAGGCCCTGGAAGTGG - Intronic
1131906714 15:97150640-97150662 GGACAAGTCTGGGCTGAATCTGG - Intergenic
1132104864 15:99056063-99056085 TGACAAGCCTGGGCTTAAAAGGG + Intergenic
1132696836 16:1205784-1205806 GGACAAGCCAGGTCTGGCTGTGG + Intronic
1135671416 16:24378718-24378740 GGATAAGCCTGGGGTAGTAGGGG - Intergenic
1136297005 16:29309410-29309432 GGACCAGCCTGGGCCAGGAGGGG - Intergenic
1137424181 16:48363680-48363702 GGAGAACCCTAGGCTGCAAGGGG - Intronic
1137586658 16:49667933-49667955 TGAGAAGCCTGGGCTGGCAGAGG + Intronic
1137616468 16:49850894-49850916 TGTCAAGCCTGGACTGGATGTGG - Intronic
1138304324 16:55960488-55960510 GGACACCTCAGGGCTGGAAGGGG - Intergenic
1138658142 16:58502280-58502302 GGATAGGCCTGGGATGGGAGGGG + Intronic
1139335873 16:66230821-66230843 GGGCCAGCCTGGCCTGGCAGAGG + Intergenic
1139446441 16:67001210-67001232 GGGCAAGGCTGGGCTGGGTGGGG + Intronic
1140409898 16:74735161-74735183 GGCCGAGCCTGGGCTGTGAGTGG - Intronic
1140472836 16:75224790-75224812 GTACACGCCAGGGCTGGAGGTGG - Exonic
1141590657 16:85066575-85066597 GGCCCATCCTGGGCTGGAAACGG - Intronic
1142108373 16:88318322-88318344 GGAGGAGGCTGGGCTGGAGGGGG - Intergenic
1143492841 17:7294224-7294246 GGACAAGCCGGTGCTGGGTGAGG - Exonic
1143755482 17:9064237-9064259 GGAGAAGGCTGGCCAGGAAGTGG - Intronic
1144665298 17:17098385-17098407 GGACAGGCCTGGGTGGGAAGAGG - Intronic
1145902136 17:28496143-28496165 GAACACGCCTGGGGAGGAAGGGG - Intronic
1146442620 17:32910435-32910457 GGACAACTGTGGGCTGGAAGAGG - Intergenic
1146540045 17:33686101-33686123 GGAAGAGCCTGGGCTGGAGTGGG + Intronic
1146936473 17:36815398-36815420 GGACAAGCCTGGGCAGAGATAGG - Intergenic
1147725560 17:42564342-42564364 GGAGGAGCCTGGGTAGGAAGGGG + Intronic
1148180485 17:45601471-45601493 AGACGAACCTGAGCTGGAAGTGG - Intergenic
1148268414 17:46244423-46244445 AGACGAACCTGAGCTGGAAGTGG + Intergenic
1148689167 17:49516897-49516919 GTACAAGTCTGGGCTGGGTGTGG - Intergenic
1148853007 17:50563768-50563790 GGAGAAGCCTGGGTTGGCTGAGG + Intronic
1148919582 17:51018825-51018847 GGACATGGCAGGGCTGGCAGCGG - Intronic
1149521527 17:57321656-57321678 GGACAAGGGTGAGCTGGAAAGGG + Intronic
1149829311 17:59857312-59857334 GGAGATCCCAGGGCTGGAAGTGG + Intergenic
1150103934 17:62447954-62447976 GGACAAGCCAGGGCTGCCTGGGG - Intronic
1150604123 17:66676442-66676464 GGGCAAGCCTGGTGTGGGAGAGG - Intronic
1151539294 17:74757064-74757086 GGGCAAGCCTGGGATGGAGCAGG - Intronic
1151822495 17:76504278-76504300 GGAGAAGCCTGGGGAGGCAGCGG + Intergenic
1151930445 17:77228648-77228670 GGCCTGGCCTGGGCGGGAAGGGG - Intergenic
1152008040 17:77694734-77694756 GGACCAGCCTGTGCAGGGAGTGG - Intergenic
1152220638 17:79063317-79063339 GAAGAAGCCTGGGATGAAAGAGG - Intergenic
1152451222 17:80381678-80381700 GGAGAAGCCTGCGCAGGACGAGG - Exonic
1152796314 17:82309297-82309319 GGCCAAGCCTGGAGTGGGAGGGG + Intergenic
1152848754 17:82618901-82618923 GGAGAAGCTTGGGCTGCTAGGGG - Intronic
1153636564 18:7117886-7117908 GGCCAAGCCGGGGCGGGACGGGG - Intergenic
1156610523 18:38718742-38718764 GGATAAGCGTGGGCGGGAACCGG - Intergenic
1157483433 18:48070555-48070577 GGAGAACCCTGTGCTGGAAAAGG - Intronic
1160158848 18:76455582-76455604 ACACAAGCCTGGGCTGCCAGGGG - Intronic
1160698158 19:494477-494499 GCACCAGCCTGGGCAGGAGGGGG + Intronic
1160703396 19:518450-518472 GGAGAGGCCAGGGCTGGGAGGGG + Intronic
1160912182 19:1479584-1479606 GGACCCGCCTTGGCCGGAAGTGG - Intergenic
1161482445 19:4517732-4517754 GGCCAAGCCTCGGCAGGAACGGG + Intergenic
1162760567 19:12886040-12886062 GGACCAGCCCGGGGAGGAAGAGG - Exonic
1163234670 19:16023541-16023563 GGGGAGGCCTGGGCAGGAAGGGG - Intergenic
1163238096 19:16041429-16041451 GTCCAAGCCTGGGCTGTATGTGG - Intergenic
1163430584 19:17264765-17264787 GGCCAAGCCTGGCCTGGGAGGGG + Exonic
1163478320 19:17539778-17539800 GGCGGAGCCTGGGCTGGGAGGGG + Intronic
1163711934 19:18852164-18852186 GGAGAAGCCGGGGGTGGACGAGG + Exonic
1164915219 19:32046640-32046662 TTAGAAGCCTGGGCTGGAGGAGG - Intergenic
1165005187 19:32799375-32799397 GGGCAAGCCTGCTCTGGCAGGGG - Intronic
1165066530 19:33232447-33232469 GGAGATACCTGGGCTGGACGTGG - Intergenic
1165399549 19:35589221-35589243 GGCCCAGCCTGGGCTGGATCTGG - Intergenic
1165443754 19:35845553-35845575 GGTCAAGCCAGGGCTGCGAGCGG + Intronic
1165494776 19:36146068-36146090 GGACATGCTGGGGCTGGGAGTGG + Intronic
1167300590 19:48675362-48675384 GGACAACCCTGGCTTGGAGGAGG - Intergenic
1167397262 19:49238794-49238816 GAACAAACCTGGGCTGGGCGCGG - Intergenic
1167915257 19:52735071-52735093 AGCCAGGCCTGGGCGGGAAGTGG + Intronic
926803805 2:16686099-16686121 GGACAAGCCTGGGGGACAAGAGG + Intergenic
927461367 2:23301175-23301197 TCACAAGCCAGGGCTGAAAGAGG + Intergenic
927699244 2:25257554-25257576 TGACAAGACTAGGCTGTAAGGGG + Intronic
928569237 2:32586615-32586637 AGACCAGCCTGGGCAGCAAGGGG - Intronic
929183946 2:39074057-39074079 AGACCAGCCTGGGCTGGGCGCGG + Intronic
932485822 2:72083841-72083863 AGACCAGCCTGAGCTGGAACAGG + Intergenic
932569244 2:72929338-72929360 GGTCCAGGCTGGGCTGAAAGAGG + Intronic
933990433 2:87630001-87630023 GGTCAAGGCTGGTCTGGAAAAGG + Intergenic
936025014 2:109024746-109024768 GGACAAACCTTCACTGGAAGAGG + Intergenic
936264548 2:110992721-110992743 GGACAAGCCAGAGCTGAATGGGG - Intronic
936303413 2:111320823-111320845 GGTCAAGGCTGGTCTGGAAAAGG - Intergenic
936997850 2:118434019-118434041 GAAATATCCTGGGCTGGAAGTGG + Intergenic
937608236 2:123827104-123827126 GGAGAAGCATGGGCAGGAACGGG - Intergenic
938405968 2:131033398-131033420 GGCCAGGCCTGGGCAGGCAGGGG - Intronic
938427145 2:131201853-131201875 GGACGGGCCTGAGCTGGGAGGGG + Intronic
940317097 2:152336600-152336622 GCACAAGCCTCGGCTGGGAGGGG - Intronic
942949564 2:181707281-181707303 GGAGAAGACTTGGCTGGAGGTGG + Intergenic
943777253 2:191779574-191779596 GGAAAAGGCTGAGCAGGAAGAGG + Intergenic
944112263 2:196145209-196145231 GGAGAGGCCTGGGCTGTAGGTGG + Intronic
945744880 2:213708501-213708523 AGACCAGCCTGGGCTGGGTGTGG + Intronic
946208667 2:218129586-218129608 GGAAAAGCATGGGCAGCAAGTGG - Intronic
946302554 2:218832687-218832709 GGCCAGGGCTGGGATGGAAGAGG - Intergenic
946419809 2:219558322-219558344 GTACAAGGACGGGCTGGAAGTGG - Exonic
946420000 2:219559363-219559385 GTACAAGGATGGGCTGGAAGTGG - Exonic
947371681 2:229452916-229452938 TGACAAGCCTTGGCTGGGTGTGG - Intronic
947534565 2:230932779-230932801 GGCCGAGCCTGGGCTAGAACAGG - Intronic
947701999 2:232242377-232242399 GCAAAGGCCTGGGCTGAAAGGGG + Intronic
948523138 2:238554278-238554300 GGACAGGCCTGGCCTGGGAGGGG - Intergenic
948670733 2:239566956-239566978 GGAGAGGCCTGGGGTGGCAGGGG + Intergenic
1169076073 20:2760459-2760481 GGCCACGCCTGGGCTGGGTGGGG + Intergenic
1169169058 20:3449404-3449426 GGACAAGGATGGGAGGGAAGGGG - Intergenic
1169422531 20:5471613-5471635 GGACAAGCCTGGGATGGAAAGGG + Intergenic
1171320826 20:24242601-24242623 GGGACAGCCTGGGTTGGAAGGGG - Intergenic
1172113258 20:32559852-32559874 GGGCAGGCCTGGGCTGGCCGTGG - Intronic
1172390380 20:34561289-34561311 GGACCTGGCTGGGATGGAAGTGG - Intronic
1172414970 20:34757744-34757766 AGAGAACCCTGGGCTGGAGGAGG + Exonic
1172606407 20:36217130-36217152 TGACAAGCGTGTGTTGGAAGTGG + Intronic
1172665097 20:36593603-36593625 TGACAGGGCTGGGATGGAAGAGG - Exonic
1172948944 20:38709828-38709850 AGACTACCCTGGGGTGGAAGGGG + Intergenic
1173334475 20:42101587-42101609 AAACAAGCATGGGGTGGAAGCGG - Intronic
1175514302 20:59559238-59559260 GGACAAGGCTGGGCTGGCCTGGG + Intergenic
1175529234 20:59662761-59662783 GGCCAGTCCTGGGCTGGAAATGG + Intronic
1175988012 20:62773817-62773839 GCACAAGGCTGGGCTGGACTGGG - Intergenic
1179113292 21:38465932-38465954 GGAGGTGCCTGGGCTGGAATGGG + Intronic
1179597045 21:42449936-42449958 GGACAGAGCTGGGCTGGAAAAGG + Intergenic
1180948925 22:19712101-19712123 TAAAATGCCTGGGCTGGAAGGGG - Intergenic
1181745015 22:24950280-24950302 AGAAAAGCCAGGGCTGGGAGTGG + Intergenic
1181763734 22:25076386-25076408 GGCCAAGCGTGGGCTGCAACAGG + Intronic
1182358744 22:29734582-29734604 GGAGAAGCGGGGGCTGGGAGGGG + Intronic
1182420041 22:30244582-30244604 GGGGAAGCTTGGGCAGGAAGTGG + Intronic
1183622641 22:38983471-38983493 GGACAGGGCTGGCCTGGAAAGGG + Intronic
1183638364 22:39078411-39078433 GGACAGGGCTGGCCTGGAAAGGG + Intronic
1184301454 22:43563155-43563177 GGGCCAGCCTAGGCTGGAAGAGG + Intronic
1184866800 22:47205855-47205877 GTGCAAGCCTGGGATGGACGTGG + Intergenic
1185371962 22:50465096-50465118 GGGCCAGCGTGGGCTGGTAGAGG - Exonic
950024561 3:9811213-9811235 GTTCGAGGCTGGGCTGGAAGGGG - Intronic
950215654 3:11156356-11156378 GGCCAATGCTGGGCTGGGAGTGG + Intronic
950501464 3:13366476-13366498 GATCAAGCCTGGGATGAAAGAGG - Intronic
952423734 3:33153707-33153729 CCACAAGCCTGGGTTGGAAAAGG - Exonic
952817168 3:37455783-37455805 GGAGAAGAATGTGCTGGAAGTGG + Intronic
952958554 3:38575718-38575740 GGACAAGGCTGGGCTGGGATAGG + Intronic
954130886 3:48560366-48560388 GGACAATCCTTTGCTGGAAATGG - Intronic
954146953 3:48639255-48639277 GGACAAGGAGAGGCTGGAAGTGG - Intronic
955219631 3:57012883-57012905 GGAGAAGCATGGGCAGGAACCGG + Intronic
955265949 3:57444881-57444903 GGGCAGGCCGGGGCTGGGAGGGG - Intronic
956513910 3:70024991-70025013 GGAGAAGATGGGGCTGGAAGAGG + Intergenic
957056197 3:75444774-75444796 GGAGAGGCCTGGGCAGGAACCGG - Intergenic
959116778 3:102187892-102187914 GGAGAAGCCTGGGCTGGCAATGG + Intronic
959225944 3:103584793-103584815 GGACAAGCTTGGGGTGAAGGAGG + Intergenic
961626721 3:128269258-128269280 GGAGATGCCTGGGCTGGTAGTGG + Intronic
961663782 3:128484137-128484159 GCAACAGCCTGGGCAGGAAGAGG + Intronic
962595845 3:136942747-136942769 GGAAAAGCCTGGACAGAAAGGGG - Intronic
963572503 3:147015645-147015667 GCTCAAGCCGTGGCTGGAAGGGG + Intergenic
964802167 3:160568318-160568340 GGAGAAGCTGAGGCTGGAAGCGG + Intergenic
965577072 3:170228399-170228421 AGACCAGCCTGGGCTGAATGTGG + Intronic
965799157 3:172473993-172474015 GGACAGCCCAAGGCTGGAAGCGG + Intergenic
966542874 3:181111287-181111309 AAACAAGCCTGGGAAGGAAGTGG - Intergenic
968091288 3:195899943-195899965 GGCAAAGCCGGGGCTGGGAGAGG - Intronic
968966955 4:3773592-3773614 GGCCAAGCCAGAGCAGGAAGTGG - Intergenic
969448603 4:7259940-7259962 GCACCAGCCTGGGCTGTCAGAGG - Intronic
969484929 4:7466885-7466907 GGACAGGGCTGGGATGGAAATGG + Intronic
969643258 4:8411826-8411848 TTCCAAGACTGGGCTGGAAGTGG - Intronic
971750296 4:30638487-30638509 AGACAAGCATGGGCTGCCAGGGG - Intergenic
972675737 4:41257650-41257672 GGACGTGCTGGGGCTGGAAGAGG + Exonic
975411537 4:74057775-74057797 GGTGAAGCATGGGCTGAAAGTGG + Intergenic
976556578 4:86457869-86457891 GAACAAATCTGGGCTGGGAGCGG + Intronic
977280974 4:95039689-95039711 GGCCAAGCATGGGCTGCATGTGG - Intronic
977477889 4:97536701-97536723 GGAAGAACATGGGCTGGAAGAGG + Intronic
979350631 4:119640782-119640804 GTACAAGCCTAGGCTGGATACGG + Intergenic
979465037 4:121027226-121027248 GGACAAGCCTGGGCAACATGGGG + Intergenic
980174389 4:129326936-129326958 GAACAAGCCTGCCCTGGCAGGGG - Intergenic
982291408 4:153786479-153786501 GGCCAAGTCTGGACTGGGAGGGG + Intronic
985884477 5:2666256-2666278 GATCAAGCCTGGGCTGCATGCGG + Intergenic
988964597 5:36403592-36403614 GGAATAGCCTGGGCTAGAAAAGG + Intergenic
992172722 5:74120506-74120528 GGTCTAGTCTGGACTGGAAGAGG - Intergenic
992468573 5:77031002-77031024 GGCCTCGCCTGGGCTGGATGGGG - Intronic
994978867 5:106846445-106846467 GGAAAAGCCTGGGGTAAAAGAGG + Intergenic
995039142 5:107568426-107568448 GGACATGCCTAGGCAGGTAGTGG + Intronic
995798124 5:115962625-115962647 ATAGAAGCCTGAGCTGGAAGGGG - Exonic
998591708 5:143485881-143485903 GGACTAGTCTGGGCTGGGTGTGG + Intergenic
999576003 5:152978229-152978251 GGCCCAACCTGGGCTGGAATGGG - Intergenic
1000776742 5:165429123-165429145 GGAGAAGCATGAGCAGGAAGAGG + Intergenic
1001023820 5:168206520-168206542 AGACAGGCCTGGGGTGGAGGAGG + Intronic
1001271609 5:170316551-170316573 GGTCAAGGCTGGGCTGGACCAGG + Intergenic
1001342737 5:170862266-170862288 GGCCGAGCCTGGGTTGGAGGCGG + Intronic
1001566187 5:172700876-172700898 GGAGCAGCCTGGGCTGCCAGGGG + Intergenic
1002276485 5:178107334-178107356 GAACAATCTTGGGCTGGATGTGG + Intergenic
1002297947 5:178241715-178241737 GGGCCATCTTGGGCTGGAAGTGG - Intronic
1002570636 5:180137589-180137611 GGACAAGCCGGTGCTGGACAAGG - Exonic
1003168891 6:3704767-3704789 GGACAAGGCTGGCCAGGTAGAGG + Intergenic
1003334642 6:5159101-5159123 GGAGAAAGCTGGGCTGGAGGGGG + Intronic
1003968701 6:11278136-11278158 TGACTAGCCTGGACAGGAAGCGG - Intronic
1006340073 6:33442051-33442073 GGACTAGCATGGGCAGGCAGAGG - Intronic
1006814000 6:36838884-36838906 GGACGAGCCTGGGAGGGATGGGG + Intronic
1006967761 6:38006809-38006831 GGATGAGTCTGGACTGGAAGAGG - Intronic
1007205765 6:40149173-40149195 GAACAAGCCTGGACTGGAGCAGG + Intergenic
1008641983 6:53473808-53473830 CCACAAGCCTGGGGTGGTAGTGG - Intergenic
1008683873 6:53903169-53903191 GGAAAAGCCTTGGCAGGATGGGG + Intronic
1009683265 6:66925372-66925394 AGACAAACCTGGACTGGTAGAGG - Intergenic
1010562211 6:77364285-77364307 GGTCAAGACTGGGTTGGCAGTGG - Intergenic
1011139372 6:84135570-84135592 AAACAAGCCTGGGCTGGTCGTGG + Intronic
1013305267 6:108841788-108841810 CGACAGGCCTAGGCTGGATGGGG - Intergenic
1013354553 6:109335504-109335526 GCACACCCCTGGCCTGGAAGTGG + Intergenic
1014781989 6:125575083-125575105 GGAGAAGCCTTTGCTGCAAGTGG - Intergenic
1018086101 6:160302470-160302492 GGAGGAACCTGGCCTGGAAGGGG + Intergenic
1018395379 6:163374196-163374218 GCACAGTTCTGGGCTGGAAGGGG + Intergenic
1018430356 6:163716938-163716960 AGACAACCCTGTGATGGAAGTGG + Intergenic
1019321764 7:419229-419251 GGACAAGCCTGGGGTGTCCGGGG + Intergenic
1019338043 7:494412-494434 GGCCAAGGCTGGACCGGAAGTGG - Intergenic
1019686883 7:2386962-2386984 GGCCAGGCCTGGGCTGCAGGAGG - Intergenic
1020093070 7:5352260-5352282 GGAGAAGCCTGGACTGGGAGGGG - Intronic
1020150404 7:5677684-5677706 GGTCAGGCCAGGACTGGAAGGGG - Intronic
1021702946 7:23337956-23337978 AGACAATCCAAGGCTGGAAGTGG - Intronic
1022195800 7:28066278-28066300 GGCCAGGTCAGGGCTGGAAGTGG + Intronic
1022226782 7:28371540-28371562 GGCCAGGCCTGAGCTGGAACAGG + Intronic
1022778616 7:33554706-33554728 GGAAAAGCCTGGGCTGCAGATGG + Intronic
1023043774 7:36194499-36194521 TAACAAGCCTGGGAAGGAAGGGG - Intronic
1023043808 7:36194672-36194694 GGCCAGGCCTGGGCTGGACCCGG + Intronic
1023393509 7:39732323-39732345 GAACGGGGCTGGGCTGGAAGTGG - Intergenic
1023766112 7:43512252-43512274 GGACAAGCCAGGGCAGGATTTGG + Intronic
1024019123 7:45349185-45349207 AGAAGAGCCTGGGCTGGAGGAGG + Intergenic
1024509884 7:50195666-50195688 GGACAAGCCTGGCCTGGAGGAGG + Intergenic
1025142549 7:56478282-56478304 GAAAAAGACTAGGCTGGAAGGGG + Intergenic
1026864607 7:73815638-73815660 GGGCAAGGATGGGCTGGATGAGG + Intronic
1027048991 7:75009759-75009781 GGACAGGGCTTGCCTGGAAGAGG + Intronic
1027249557 7:76390384-76390406 GGACAGGGCTGGGTTGGAAGGGG + Intronic
1029607123 7:101605890-101605912 GGACATGGCTGGGGTGGAAGTGG - Intergenic
1029702324 7:102255194-102255216 GGAGAGGCCTGGGCAGGAGGAGG - Exonic
1030117186 7:106070845-106070867 CAACAAGCCTGGGCAGGAATGGG + Intergenic
1030375509 7:108748838-108748860 TGACAAGCATGGGATGGGAGGGG - Intergenic
1032033115 7:128501151-128501173 GGACAAGCCAGGGCTGCCTGGGG - Intronic
1032216223 7:129959416-129959438 GGTAAATCCTAGGCTGGAAGGGG - Intergenic
1032224862 7:130023238-130023260 GGACAAACCTGATCTGGCAGCGG - Intronic
1033132859 7:138760040-138760062 GGGCAAGTCAGGGCTGGATGCGG - Intronic
1033348194 7:140541459-140541481 AGAAAGGCCTGGGCTAGAAGTGG - Intronic
1033652188 7:143351869-143351891 GGAGAGTCCAGGGCTGGAAGAGG + Exonic
1035372874 7:158390653-158390675 GGGCAAGCCTGGCCGGGCAGTGG - Intronic
1036594495 8:10200032-10200054 GAACAAGCCTGAGCTTCAAGAGG - Intronic
1036644134 8:10601521-10601543 GGATAAGCCTGGGATGGCTGGGG + Intergenic
1036649296 8:10632104-10632126 GGGCAACCCTGGCCCGGAAGAGG + Intronic
1039434784 8:37552602-37552624 AGACAGGCCTGGGCTGGGAAGGG - Intergenic
1040875542 8:52148064-52148086 GCACAAGCCTGAGGTGGCAGTGG + Intronic
1042114495 8:65415691-65415713 AAACAAGCCTGGGCTGGGATGGG - Intergenic
1042874655 8:73429949-73429971 AGTCAACCCAGGGCTGGAAGCGG - Intronic
1043857123 8:85276063-85276085 GGAGAGGCGTGGGCGGGAAGTGG + Intronic
1045216164 8:100150558-100150580 GGCCACGCCTGGGGCGGAAGGGG + Intergenic
1046831715 8:118753341-118753363 GGATAGGCCTGGGATTGAAGTGG - Intergenic
1047615212 8:126557756-126557778 TGCCAAGCTTGGGCAGGAAGAGG + Intronic
1047850437 8:128851594-128851616 GGACATCCTTGGGGTGGAAGTGG - Intergenic
1047938296 8:129803038-129803060 GCACAAGCCTGGCCTGGAAAGGG + Intergenic
1048242956 8:132762347-132762369 AGATAAGCCAAGGCTGGAAGAGG - Intergenic
1048257428 8:132915576-132915598 GGACACACCTGGGCTGGAACAGG + Intronic
1048577706 8:135706118-135706140 GGGGAAGCCAGGTCTGGAAGGGG + Intergenic
1048977375 8:139680471-139680493 GCACAGTCCTGGGCTGGAGGAGG + Intronic
1049271139 8:141696917-141696939 CAGCAGGCCTGGGCTGGAAGTGG - Intergenic
1049384789 8:142337742-142337764 GGCCCAGTCGGGGCTGGAAGCGG - Intronic
1049720598 8:144113743-144113765 GGAGAAGCCTGGGGAGGAGGGGG + Exonic
1049795968 8:144497395-144497417 GGACAACACTGGGAGGGAAGAGG - Exonic
1051459466 9:17295189-17295211 GGACAGGCGTGGGCGGGAACTGG - Intronic
1053527921 9:38848317-38848339 GCAAGAGTCTGGGCTGGAAGTGG - Intergenic
1054200142 9:62072753-62072775 GCAAGAGTCTGGGCTGGAAGTGG - Intergenic
1054638213 9:67515607-67515629 GCAAGAGTCTGGGCTGGAAGTGG + Intergenic
1054870588 9:70044377-70044399 GGCCAAGCCTGGGGTGGGGGTGG + Intronic
1055550915 9:77431586-77431608 GGAGAAGCCTGGCCTGGCACTGG - Intronic
1055846014 9:80564258-80564280 GTAGAAGCCTGCGCTGGAACCGG - Intergenic
1056164921 9:83931667-83931689 AGACAAGCCTGGGCAACAAGGGG + Intergenic
1056708662 9:88972514-88972536 GGATAAGCCTGGGCTCTAGGGGG - Intergenic
1056825926 9:89876370-89876392 GGACAGGGCTGAGCTGGGAGGGG - Intergenic
1057209292 9:93190972-93190994 GGACACATCAGGGCTGGAAGAGG + Intronic
1057512612 9:95693274-95693296 GGACCACCCTGAGCTGGTAGCGG - Intergenic
1058569799 9:106328638-106328660 GGGCAAGCCAGGACTGGACGTGG + Intergenic
1058966513 9:110044007-110044029 AAACAAACCTGGGCTGGATGTGG - Intronic
1059734018 9:117083902-117083924 GGACCATCATGGGCTGGAGGAGG + Intronic
1060044749 9:120331054-120331076 AGAGAAGCCTGGCCTGGAAGAGG - Intergenic
1061014913 9:127975964-127975986 GGCCAGGCCTGGGCTGGCACTGG - Intronic
1061114981 9:128604424-128604446 GGTCAGCCCTGGGCTGGGAGAGG + Intronic
1061160728 9:128892480-128892502 GGAGACGCCAGGGCTGGAGGGGG - Intronic
1061565866 9:131439528-131439550 GGTGAAGCCTTGGCTGGCAGGGG - Intronic
1061580230 9:131531585-131531607 AGAGGAGCCTGGGCTGGAGGGGG - Intergenic
1061604277 9:131697160-131697182 GGAGAAGCCTGGGCCAGCAGAGG - Intronic
1061688036 9:132299850-132299872 GGACAAGTCTCGGCTGGGCGCGG + Intronic
1062097045 9:134708880-134708902 GGGCCACCCGGGGCTGGAAGCGG - Intronic
1062578822 9:137220951-137220973 GGACATGCCTGCCTTGGAAGGGG - Exonic
1062681624 9:137785099-137785121 GGAAGAGCGTGGTCTGGAAGAGG + Intronic
1185520388 X:734335-734357 GGACCAGCCTGCATTGGAAGCGG + Intergenic
1185596221 X:1308570-1308592 GGGCAACCCTGGGCTGCAACTGG - Intronic
1186517575 X:10177530-10177552 GGACTAGCGGGGGCTTGAAGTGG + Intronic
1189019566 X:37320224-37320246 AGACACACCTGGGCCGGAAGGGG - Intergenic
1189491537 X:41474637-41474659 GGACGGGCCTGGACTGGACGTGG - Exonic
1190061560 X:47214976-47214998 TGGGAACCCTGGGCTGGAAGGGG - Exonic
1190216181 X:48480909-48480931 GGAACAGTCTGGGCTGGAGGTGG + Intronic
1190302696 X:49065674-49065696 TAGCAAGCCTGGGCTGGCAGAGG + Intronic
1191896451 X:65998286-65998308 GGCCAAGCCTGGGGTAGAGGTGG + Intergenic
1195373223 X:104200689-104200711 AGACAAGCCTGGGCAGCATGGGG - Intergenic
1195655988 X:107332109-107332131 GGAGAAGCCTGGCCTGGGAGTGG + Intergenic
1196197958 X:112855215-112855237 GGACAGGCATGGGCGGGAAGCGG - Intergenic
1197061587 X:122187603-122187625 GCACATGCCTGAGCTAGAAGAGG - Intergenic
1197750657 X:129961438-129961460 GGGCAAGCTGGGGCAGGAAGTGG + Intergenic
1197942082 X:131801153-131801175 GGAAAAGCATGGGAAGGAAGAGG - Intergenic
1200203465 X:154298511-154298533 GGACAAGCCTGGGCAACATGGGG + Intronic
1202349202 Y:23969389-23969411 TCCCAATCCTGGGCTGGAAGAGG + Intergenic
1202521573 Y:25700715-25700737 TCCCAATCCTGGGCTGGAAGAGG - Intergenic