ID: 1077279271

View in Genome Browser
Species Human (GRCh38)
Location 11:1734750-1734772
Sequence CAGGGCCTGGAGAAGTCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 412}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077279271_1077279278 -2 Left 1077279271 11:1734750-1734772 CCTCCAGACTTCTCCAGGCCCTG 0: 1
1: 0
2: 3
3: 38
4: 412
Right 1077279278 11:1734771-1734793 TGCCAGGGACACAAAGTAGAAGG 0: 1
1: 0
2: 1
3: 22
4: 247
1077279271_1077279282 7 Left 1077279271 11:1734750-1734772 CCTCCAGACTTCTCCAGGCCCTG 0: 1
1: 0
2: 3
3: 38
4: 412
Right 1077279282 11:1734780-1734802 CACAAAGTAGAAGGCTGGGCTGG 0: 1
1: 0
2: 5
3: 21
4: 273
1077279271_1077279284 18 Left 1077279271 11:1734750-1734772 CCTCCAGACTTCTCCAGGCCCTG 0: 1
1: 0
2: 3
3: 38
4: 412
Right 1077279284 11:1734791-1734813 AGGCTGGGCTGGAGCTGCATGGG 0: 1
1: 0
2: 3
3: 46
4: 371
1077279271_1077279281 3 Left 1077279271 11:1734750-1734772 CCTCCAGACTTCTCCAGGCCCTG 0: 1
1: 0
2: 3
3: 38
4: 412
Right 1077279281 11:1734776-1734798 GGGACACAAAGTAGAAGGCTGGG 0: 1
1: 0
2: 1
3: 30
4: 276
1077279271_1077279280 2 Left 1077279271 11:1734750-1734772 CCTCCAGACTTCTCCAGGCCCTG 0: 1
1: 0
2: 3
3: 38
4: 412
Right 1077279280 11:1734775-1734797 AGGGACACAAAGTAGAAGGCTGG 0: 1
1: 0
2: 6
3: 154
4: 1113
1077279271_1077279283 17 Left 1077279271 11:1734750-1734772 CCTCCAGACTTCTCCAGGCCCTG 0: 1
1: 0
2: 3
3: 38
4: 412
Right 1077279283 11:1734790-1734812 AAGGCTGGGCTGGAGCTGCATGG 0: 1
1: 0
2: 8
3: 64
4: 643

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077279271 Original CRISPR CAGGGCCTGGAGAAGTCTGG AGG (reversed) Exonic
900165096 1:1241373-1241395 CAGGGGCTGGGGCTGTCTGGAGG - Intergenic
900373407 1:2342540-2342562 TGGGGCCTGGAGAAGTCAGCGGG + Intronic
900406529 1:2495419-2495441 CAGGCCTTGGCGAAGGCTGGGGG - Intronic
900479409 1:2890865-2890887 CAGGGCCTGGAAGAGGCAGGAGG - Intergenic
900486013 1:2923162-2923184 CAGGGCCTGGGCAGGGCTGGGGG - Intergenic
900591829 1:3463559-3463581 AAGGGCCTGGGGAAGCCAGGTGG + Exonic
900719669 1:4167114-4167136 CAGGGCCTGGAGTTGTCTGCTGG + Intergenic
900796111 1:4709293-4709315 TGGGGCCTGGTGAAGCCTGGTGG + Intronic
900796120 1:4709324-4709346 CAGGGCCTGGTGGAGTATAGTGG + Intronic
901012520 1:6209691-6209713 CAGGGCCTGCCGCAGGCTGGTGG + Intronic
901533961 1:9870897-9870919 CAGGAAATGGAGATGTCTGGGGG - Intronic
901772163 1:11535961-11535983 CAGGGGCTGGAGCAGACTTGTGG - Intronic
902488038 1:16760921-16760943 CTGGGCCTAGATAAGACTGGGGG - Intronic
903548906 1:24143981-24144003 CAGGGCCTGGAGAAGGTAGAAGG + Intergenic
903661946 1:24983828-24983850 CAGGGCCTGTTGAGGTGTGGTGG + Intergenic
903753838 1:25647170-25647192 TGGGGCCTGGGGAAGTCAGGTGG + Intronic
903767490 1:25744076-25744098 AAGGGCCTGGAAGAATCTGGGGG - Intronic
903846234 1:26281170-26281192 CATGGCCAGGTGAAGGCTGGGGG - Exonic
904339347 1:29824119-29824141 GATGGCCTGGAGAACTCAGGAGG - Intergenic
904360949 1:29971434-29971456 GAGGGCCAGGAGAGCTCTGGAGG - Intergenic
904371150 1:30048241-30048263 GATGGCCTGCAGAGGTCTGGAGG - Intergenic
904496864 1:30892038-30892060 CAGGACCTGCAGGAGGCTGGAGG - Intronic
907266730 1:53266286-53266308 CTGGGGCTGGAGTAGTCTGAGGG - Intronic
912078675 1:105910140-105910162 CAGGGACTGGGGTAGTCTAGGGG - Intergenic
912208612 1:107534714-107534736 CAGGGCCTGGTCAACTCAGGAGG - Intergenic
912584390 1:110749251-110749273 TAGGGCCTGGAGAAGAGAGGAGG + Intergenic
914900693 1:151709671-151709693 CAGGGCCTGGAGTTGTCGAGGGG - Intronic
915120878 1:153628960-153628982 CAGGTCCCGGGGGAGTCTGGGGG + Intronic
915275367 1:154784566-154784588 CAGGGCCTGGGGAATACTGGAGG - Intronic
915580714 1:156811505-156811527 CAGGGCGTAGGGAAGTCTGGGGG - Intronic
916703384 1:167321533-167321555 CAAAGACTGGAGAATTCTGGAGG + Intronic
916917250 1:169421518-169421540 CAGAGCTTGGACAAGTCTTGCGG + Exonic
918284915 1:183042800-183042822 CAGTGCCAGGAGAGGGCTGGGGG - Intronic
918570117 1:185980532-185980554 CAATGACTGGAGAAGTCTGCTGG - Intronic
919804386 1:201372531-201372553 CAGGGGCTGGAATAGTCAGGGGG - Intronic
920272886 1:204780051-204780073 CAGGGCCAGGAGAAATCTTATGG - Intergenic
920298176 1:204972512-204972534 CAGAGGCTGGAGAGGGCTGGGGG - Intronic
921184426 1:212657403-212657425 CAGGGCCTGGGGTAGACTAGAGG - Intergenic
922856059 1:228775545-228775567 CAGGGCATGGACATCTCTGGGGG + Intergenic
923092766 1:230752573-230752595 CCAGGCCTGCAGAAGGCTGGGGG + Intronic
923198109 1:231687132-231687154 CAGAGGCTGGAACAGTCTGGAGG - Intronic
923674393 1:236066992-236067014 CAGGGCATGGGGAAGTCGTGGGG - Intergenic
924687717 1:246312475-246312497 CAGGGCATACAGAAGTTTGGGGG + Intronic
1063421412 10:5915386-5915408 CAGTGCCTGGGGAAGCCAGGAGG - Exonic
1063814700 10:9758827-9758849 CAGGACCTGGGGAACTTTGGTGG - Intergenic
1066372633 10:34830146-34830168 CAGGGCCTGGAAAAGGCAGGAGG - Intergenic
1067553093 10:47248728-47248750 CATGGTCTGGTGAAGCCTGGAGG - Intergenic
1068252013 10:54455320-54455342 CAGAGGCTGGAAAAGTTTGGAGG + Intronic
1068831441 10:61499421-61499443 GAGGGGCTGGAGAAGTTAGGAGG + Intergenic
1068931090 10:62591278-62591300 CTGGGACTAGAGAAGTCTAGAGG + Intronic
1069773827 10:70915516-70915538 GAGGTCCTGGAGGGGTCTGGGGG - Intergenic
1069909715 10:71751692-71751714 CGGGGCCTGGAGGAGACAGGGGG + Exonic
1072107892 10:92291308-92291330 CAGGGCCTGCGGGAGTCCGGCGG - Exonic
1072665322 10:97388488-97388510 CAGGAGATTGAGAAGTCTGGAGG - Exonic
1073134910 10:101215139-101215161 CAGGTCCTGGGGAAGGCCGGGGG - Intergenic
1073324182 10:102632985-102633007 CAGGGACTGGAGAAGCCAAGGGG + Exonic
1074089845 10:110239882-110239904 CAGTGACTGGAAAAGTCAGGAGG - Intronic
1074958861 10:118420422-118420444 CAGGGCCTGTAGTAGGGTGGGGG + Intergenic
1076068134 10:127464899-127464921 CAGGGTCTGCAGGAGTCAGGCGG + Intergenic
1076086641 10:127637653-127637675 CAGGGCAGGGTGCAGTCTGGTGG + Intergenic
1076347868 10:129792894-129792916 CAGGGACTGGAGAAGTGTGTTGG + Intergenic
1076514478 10:131036141-131036163 CAGGGCCTGAGGCAGGCTGGAGG + Intergenic
1077279271 11:1734750-1734772 CAGGGCCTGGAGAAGTCTGGAGG - Exonic
1077305059 11:1865241-1865263 CAGGGCCTGGATACCTCTTGAGG + Exonic
1077495013 11:2882766-2882788 CAAGGCCTGAAGAAGTCTGGAGG + Intergenic
1078445005 11:11397447-11397469 TAGGACCTGGAGAACTCTTGAGG + Intronic
1079586392 11:22130429-22130451 CAGTGGCTGTAGAATTCTGGAGG - Intergenic
1080016479 11:27512194-27512216 CAGGTCCCTGATAAGTCTGGGGG + Intergenic
1081605799 11:44526491-44526513 CAGGGCCTGGAGAAGGGGGTGGG - Intergenic
1081814637 11:45931705-45931727 CAGGGCCTGGAGTGGGCTTGGGG + Intronic
1082106432 11:48226693-48226715 CAGGGCCTGTTGCAGGCTGGGGG - Intergenic
1083722789 11:64611712-64611734 CAGGCCTGGGAGGAGTCTGGGGG - Intronic
1084697813 11:70766544-70766566 CAGGGCCTGGAGGTGTTTGAGGG - Intronic
1084975133 11:72792918-72792940 GAGGATCTGGAGAATTCTGGAGG - Exonic
1088596727 11:111446689-111446711 CAGGGCGTGGAGGAGTCCAGTGG - Intronic
1088893148 11:114059941-114059963 CCGGGGCTGGAGAGGTCTGGGGG + Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1091232170 11:133995717-133995739 CATGGCCTGGATAAACCTGGAGG + Intergenic
1091952107 12:4602487-4602509 CAGAGCTTGGACAAGTCTTGCGG + Intronic
1092111906 12:5970178-5970200 CAGAGGAGGGAGAAGTCTGGAGG - Intronic
1092144477 12:6205032-6205054 CAGGGCATGGACAAGTTGGGTGG + Intronic
1092233380 12:6790678-6790700 CAGGGGCTGGAAAGGTCTGAGGG - Intronic
1093905270 12:24684025-24684047 CAGGGCCTGTTGAGGGCTGGCGG - Intergenic
1094397714 12:30025703-30025725 CAGAGGTTGGAGAAGTTTGGAGG - Intergenic
1096101686 12:48973699-48973721 CGGGGCCTGGAGAGGGCTGTGGG + Intergenic
1096225455 12:49864091-49864113 CAGGGCCTTGAGGAGACTGCGGG - Intergenic
1096240020 12:49954817-49954839 CAGGACCAGGAGGAGTGTGGAGG - Intronic
1096258939 12:50078990-50079012 CCTGGCCTGGGGCAGTCTGGGGG + Intronic
1096788588 12:54031648-54031670 AAGGGCCCGGAAAACTCTGGCGG - Intronic
1097167368 12:57093089-57093111 CAGGGCCTGGGGGAGGCTGCTGG - Exonic
1098312233 12:69159436-69159458 CAGAGCCTGGGGCAATCTGGTGG - Intergenic
1098560505 12:71866382-71866404 CAGGGACTGGTGAAGTCTGTAGG + Intronic
1100990184 12:100243604-100243626 CAGGCCCTGGAGGAGGCAGGAGG - Intronic
1102825966 12:115948188-115948210 CAGGGGCTGGGGGAGGCTGGGGG + Intergenic
1103272149 12:119682205-119682227 CAGGGCTTGGAGAACTCATGGGG - Intergenic
1103725852 12:122997031-122997053 CAGGGCCTGGATAGGCTTGGGGG + Intronic
1104641655 12:130471118-130471140 CAGGGCCTGGTGAGGTCTCAGGG - Intronic
1104674948 12:130706136-130706158 CAGGGCCTGGAATAGTGTGAGGG - Intronic
1104770337 12:131357734-131357756 GAGGGGCTGGATAAGTCTGTGGG + Intergenic
1104902956 12:132199023-132199045 CAGGGCTTGGAGCAGCCTGAGGG - Intronic
1104931410 12:132341275-132341297 CAGGGACTGGAGGAGGGTGGGGG + Intergenic
1106110987 13:26776772-26776794 CAGGGCCTGTCGAAGGGTGGGGG - Intergenic
1106164068 13:27226505-27226527 GAGGTCCTGGTGAAGTGTGGTGG - Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1107402468 13:40082991-40083013 CAGGGCCTCGAAAGGTCTGCGGG - Intergenic
1107609858 13:42102357-42102379 AGGGGCCAGGAGAAGCCTGGTGG + Intronic
1109667684 13:65559938-65559960 CAGAGGCTGGAAAAGTTTGGAGG - Intergenic
1111976043 13:94968086-94968108 CCGGGCCAGTAGAAGTTTGGGGG + Intergenic
1112052156 13:95653680-95653702 CATGGCCTGGTGAGGTTTGGTGG - Intergenic
1112494791 13:99896109-99896131 CCGGGCCAGGAGGAGTGTGGCGG + Exonic
1114064022 14:19044763-19044785 CAGGGCATGCAGAACTATGGTGG + Intergenic
1114098237 14:19355233-19355255 CAGGGCATGCAGAACTATGGTGG - Intergenic
1114566957 14:23639791-23639813 CAGGCCCTGGAGCACTGTGGGGG + Exonic
1116666828 14:47787406-47787428 TAGGGCCTGCTGAAGTCTGAGGG + Intergenic
1118445949 14:65851371-65851393 CAGGGACAGGAGGAGACTGGTGG - Intergenic
1118769277 14:68931031-68931053 GAGGGGCTGGAGGAGTCAGGAGG - Intronic
1118771219 14:68943964-68943986 CAGGGACTGGTGCAGGCTGGTGG - Intronic
1119480327 14:74954600-74954622 CAGGGCCTGGGGAAGTGAGCAGG - Intronic
1119862322 14:77945163-77945185 GAGAGCCTGGAGAAGTCTAGAGG + Intergenic
1120563023 14:86019683-86019705 CAGGGCTTGGGGAAGTAGGGTGG - Intergenic
1120688132 14:87562850-87562872 CAGAGGCTGGAAAAGTCTGGAGG + Intergenic
1121017488 14:90557296-90557318 CAGGGCTGGGAGAAGTCACGTGG + Intronic
1121109645 14:91303567-91303589 CAGGGCCTGGGGAAGATGGGTGG - Intronic
1121341643 14:93108610-93108632 CAGGGCCGGGACAAATCTGTGGG - Intronic
1121648342 14:95536068-95536090 CAGGGCTTGGAGAGGTTTGTGGG + Intronic
1121816367 14:96932051-96932073 CAGGGCCCGGCGGTGTCTGGGGG + Intergenic
1121906515 14:97751007-97751029 CAGGAACTGGAGAAGGCTGAGGG + Exonic
1122630855 14:103107177-103107199 CATGCCCTGGAGAAGCCTTGAGG - Intronic
1122947747 14:105020920-105020942 CAGGGCGCGGAGGAGCCTGGGGG - Intronic
1123043435 14:105499831-105499853 CAGGGCCGGCAGGAGCCTGGAGG - Intergenic
1124003276 15:25777141-25777163 CAAGCCCTGGAGAAACCTGGAGG - Intronic
1124232135 15:27954858-27954880 CAGGGCCAGGAGCGGGCTGGTGG + Intronic
1124936872 15:34181044-34181066 AAGGACCAGGAGAAGACTGGTGG - Intronic
1125484968 15:40105461-40105483 GTTGCCCTGGAGAAGTCTGGGGG - Intronic
1126366017 15:47895324-47895346 CAGGGCCTAGATAAGTGTTGGGG + Intergenic
1126436662 15:48644902-48644924 CAGCGCCTGGAGAAGGCGGGAGG - Exonic
1126544433 15:49857301-49857323 CAAGGCCTGGAGAAGTCAGGTGG + Intergenic
1126780117 15:52132610-52132632 CAGGGCATGGTGATGTGTGGAGG - Intronic
1126864202 15:52920012-52920034 CAGGGCCAGGGGAAGTTTGTGGG + Intergenic
1128378040 15:67091235-67091257 TGGGGCCTGGAGACGGCTGGGGG - Intronic
1130255185 15:82322691-82322713 CAGTGCCAGGAGAACTCGGGCGG - Intergenic
1130543271 15:84837191-84837213 CAGGGGCTGGAGGAGGCTGTGGG + Intronic
1130599789 15:85267315-85267337 CAGTGCCAGGAGAACTCGGGCGG + Intergenic
1131519105 15:93099956-93099978 GAGGCCCAGGGGAAGTCTGGAGG + Intergenic
1132387406 15:101410230-101410252 CAGGGCCTTTAGAATTCTGCAGG + Intronic
1132471316 16:105080-105102 GAGGGGCTGGATAAGTCTTGAGG - Intronic
1132482950 16:175675-175697 CAGGCCCTGAGGAAGTCTGGAGG - Intergenic
1132836990 16:1959083-1959105 CGGGGCCCAGAGAAGTCTGTAGG + Intergenic
1132884316 16:2175864-2175886 CACGTCCTGCAGACGTCTGGTGG + Exonic
1132931384 16:2460705-2460727 CAGCACCTGGAGAAGGCGGGTGG - Intronic
1133038358 16:3046816-3046838 CCGGGCCTGGAGAGGGCGGGGGG - Exonic
1133669395 16:8003259-8003281 CAGGGCCTGTTGCAGGCTGGGGG + Intergenic
1136407267 16:30055229-30055251 CAGGTCCAGCAGCAGTCTGGGGG - Exonic
1137027315 16:35489982-35490004 GAGGGCCTGGGGAAGGATGGTGG + Intergenic
1137785510 16:51134602-51134624 CAGGGCCTGGGGACATCTGAGGG - Intergenic
1138890930 16:61143376-61143398 CAGGACTTCTAGAAGTCTGGTGG + Intergenic
1139527884 16:67528022-67528044 CAAGGCCTGGAGAAGCCTCAGGG + Intronic
1139914652 16:70420561-70420583 AAGGGCCTGCAGACGTCTGCTGG + Intronic
1140840992 16:78838892-78838914 CAGGGACTGGAGAGGAGTGGGGG + Intronic
1141717271 16:85734226-85734248 CAGGGCCTGGAACACTCTGGCGG - Intronic
1142191813 16:88721599-88721621 CTGGGCCTGGAGAAGACTGACGG - Exonic
1142347696 16:89564719-89564741 GAGGGCCTGAAGATTTCTGGTGG + Exonic
1142438941 16:90082035-90082057 CATGGCCCGGAGTAATCTGGAGG + Intronic
1142756436 17:2019102-2019124 CAAGGCCTGGAGAAGACTGAGGG - Intronic
1143362380 17:6382584-6382606 CAGGGCCTGGTGGCTTCTGGGGG - Intergenic
1143769077 17:9156434-9156456 CTGGGCCATGTGAAGTCTGGGGG + Intronic
1146276303 17:31517801-31517823 CAGAGCCTGGAGGGGTCTGTCGG + Exonic
1146455996 17:33010146-33010168 GTGGACCTGGGGAAGTCTGGTGG - Intergenic
1146969616 17:37062147-37062169 CAGGGCGTGGAGGAGCCAGGAGG + Intergenic
1147188275 17:38724677-38724699 CAGCGCCTGCAGATGGCTGGGGG + Exonic
1147315863 17:39619952-39619974 GAGGGCCTGGAGGACTCTGTTGG - Intergenic
1147883984 17:43672181-43672203 CAGGGCTGGGAGTAGCCTGGGGG + Intergenic
1148326477 17:46786163-46786185 CGGGGCATGGAGCAGTCTGGTGG + Intronic
1148416641 17:47511708-47511730 AATGGCCTGGATCAGTCTGGGGG + Intergenic
1149371758 17:56001421-56001443 CAAAGCCAGGAGCAGTCTGGGGG + Intergenic
1149990148 17:61378611-61378633 CTGGGCAGGGAGAAGGCTGGTGG - Intronic
1151279777 17:73064778-73064800 CAGGGCCTGGAGAGGTTTGCTGG - Intronic
1151458752 17:74242223-74242245 AAGGGCTTGGAGGAGGCTGGAGG + Intronic
1151560034 17:74865010-74865032 GTGGGCCTGGAGAAGGCTGGCGG + Intronic
1153056448 18:950467-950489 CAGGGCCTTGCGAGGGCTGGGGG + Intergenic
1153448032 18:5196143-5196165 CAGGGAGTGGGGAAGGCTGGAGG - Intronic
1153648171 18:7214056-7214078 AAGAGCCTGGGGAAGCCTGGAGG - Intergenic
1155340816 18:24812509-24812531 CTGGGCCTGGAAAAGTCTCTGGG - Intergenic
1155798153 18:30066066-30066088 CAGAGACTGGAACAGTCTGGAGG - Intergenic
1157293235 18:46424740-46424762 TAGGGCCTGGAGAAGTCCATGGG + Intronic
1158579894 18:58671796-58671818 CCGGGGCTGGAGGAGACTGGCGG + Exonic
1158583605 18:58708160-58708182 CAGGGCCTGTTGAAGGCTGACGG - Intronic
1160692820 19:467648-467670 CAGGGCCGGGCCAAGTCTCGGGG - Exonic
1161287048 19:3474025-3474047 CAGGGCCTGGAGAAGGTGAGGGG + Exonic
1162038766 19:7956793-7956815 AGGGGTCTGGAGAGGTCTGGTGG + Intergenic
1162130134 19:8521377-8521399 CAGGGCCTGGGCAGGACTGGAGG + Exonic
1163410441 19:17150612-17150634 CTGGGGCTGGCTAAGTCTGGTGG - Intronic
1163549521 19:17957868-17957890 GAGGCCCAGGAGATGTCTGGTGG + Intronic
1163767600 19:19172103-19172125 CAGGGCCTGGGCCAGGCTGGGGG + Intronic
1165061476 19:33207179-33207201 CAGCCCCTGGAGCAGGCTGGAGG - Exonic
1165471350 19:36006588-36006610 CAGGACCTGGTGGGGTCTGGGGG - Exonic
1167792368 19:51690077-51690099 CGGGGGCAGGAGATGTCTGGAGG + Intergenic
1168322138 19:55517076-55517098 TAGGGCCGGGTGAAGTCTGCCGG + Intronic
1168666519 19:58209111-58209133 GAGGGACAGGACAAGTCTGGAGG - Intronic
1202703161 1_KI270713v1_random:3319-3341 CTGGGCCTAGATAAGACTGGGGG + Intergenic
925182499 2:1826351-1826373 CAGGTCCTGGGGAGGGCTGGGGG + Intronic
925745582 2:7040744-7040766 CAGAGGCTGGAGGACTCTGGGGG + Exonic
925915298 2:8600338-8600360 GAGGGCTTGGAGAACTGTGGAGG - Intergenic
925996444 2:9297329-9297351 CAGGCTCTGGAGAAGTTTGGCGG + Exonic
926840066 2:17070423-17070445 CAGAGCCTGGAACAGTTTGGAGG + Intergenic
927100219 2:19782369-19782391 CAGAGACTGGAAAAGTTTGGAGG + Intergenic
928195088 2:29209835-29209857 CAGGGCCTGGACAGGTCAAGAGG + Exonic
929213152 2:39381888-39381910 CAGGGCCAGGAAAAGGCTTGTGG - Intronic
929376244 2:41289982-41290004 CAGGGTCTGGAACAGTTTGGAGG - Intergenic
929714442 2:44296132-44296154 AATGGGCTAGAGAAGTCTGGTGG - Intronic
930507643 2:52304581-52304603 CAGAGGCTGGAAAAGTTTGGAGG + Intergenic
930987448 2:57607762-57607784 CAGGGCCTGTTGGAGGCTGGGGG + Intergenic
932022387 2:68100347-68100369 CAGGGGCTGGGGAGGTTTGGAGG + Intronic
933348894 2:81127811-81127833 CAGGGCCTTGAGCAGACAGGCGG - Intergenic
933698761 2:85239324-85239346 CAGGGCAGGGAGGGGTCTGGAGG - Intronic
934048038 2:88188031-88188053 CAGGGCCTGGGGAAGGATGGAGG - Intergenic
934562612 2:95320922-95320944 GAGGGCCTAGGGAAGGCTGGGGG - Intronic
934568840 2:95355498-95355520 CAGGGCCTGTTGGAGGCTGGGGG - Intronic
935266152 2:101396014-101396036 GAGGGCCAGGAGGAGTCTGGAGG - Intergenic
935425877 2:102917874-102917896 CAGAGACTGGAAAAGTTTGGAGG - Intergenic
935644527 2:105323228-105323250 GAGAGCCTGGAAAAGTCAGGTGG + Intronic
936153201 2:110032799-110032821 CAGGGACTGGACACGCCTGGAGG + Intergenic
936191480 2:110338616-110338638 CAGGGACTGGACACGCCTGGAGG - Intergenic
936273105 2:111067812-111067834 CAGGGCCTTGGGAAGTCCAGGGG + Intronic
936797421 2:116224176-116224198 CCTGGTCTGGAGAGGTCTGGAGG - Intergenic
937318799 2:120948516-120948538 CTGGGCCTGGAGATGGCAGGTGG - Intronic
937862342 2:126720861-126720883 CACAGCCTGGGGAAGTCTGGAGG + Intergenic
938278764 2:130050370-130050392 CAGGGGGTGGAGGATTCTGGAGG + Intergenic
938329738 2:130441229-130441251 CAGGGGGTGGAGGATTCTGGAGG + Intergenic
938360208 2:130680274-130680296 CAGGGGGTGGAGGATTCTGGAGG - Intergenic
938481283 2:131663747-131663769 CAGGGCATGCAGAACTATGGTGG + Intergenic
939052820 2:137329082-137329104 CAGAGACTGGAAAAGTTTGGAGG + Intronic
939155985 2:138524878-138524900 CAGAGACTGGAACAGTCTGGAGG - Intronic
939371886 2:141311940-141311962 CAGAGGCTGGAAAAGTTTGGAGG + Intronic
940391561 2:153138385-153138407 CAGGGCTTGCAGAATTGTGGGGG + Intergenic
942462067 2:176175376-176175398 CAAGGCCTGGAGCAGCCTGGTGG - Intergenic
944628795 2:201600424-201600446 CAGGGCCTGTAGGGGGCTGGAGG + Intronic
944987418 2:205193422-205193444 CAAGGTCTGCAGAAGCCTGGAGG + Intronic
945281747 2:208041949-208041971 CAGGGTCTTGAGAAGACAGGAGG - Intergenic
947492723 2:230609961-230609983 CAGGGCCTGTTGAGGTGTGGGGG + Intergenic
948080669 2:235202820-235202842 CAGGGCTTCCAGAAGGCTGGTGG - Intergenic
948296395 2:236863835-236863857 ATGGGCCTGGAGGACTCTGGAGG + Intergenic
948781513 2:240324479-240324501 CAGGGCCTGGAGGAGGCAGAAGG - Intergenic
948869261 2:240790103-240790125 CAGGGCCTGGGAAATGCTGGGGG - Intronic
948886900 2:240889127-240889149 CAGGGCCTGGGGCAGGATGGAGG - Intronic
949075523 2:242055271-242055293 CAGCGGCCGGAGAAGTGTGGGGG + Intergenic
1168819327 20:762514-762536 CAGGGCGTGGACCAGTCTTGGGG - Intronic
1170387114 20:15831578-15831600 CAGGGGCTGAAGCAGTCAGGAGG - Intronic
1170960166 20:21018426-21018448 CAGGGCTCTGAGAAGTGTGGAGG - Intergenic
1171187356 20:23132363-23132385 CGGGGCCTGGAGCAGGCTGATGG + Intergenic
1171878153 20:30597583-30597605 CACAGCCTGGAGCAGCCTGGGGG - Intergenic
1172192170 20:33068786-33068808 CAGGGCCTGGAGAAATGCAGGGG - Exonic
1172274826 20:33673828-33673850 TGGGGCCTGAAGAACTCTGGGGG + Intronic
1172446687 20:34996990-34997012 CAGGGCCTGAAGGGGACTGGGGG + Intronic
1172875040 20:38158907-38158929 CGGGGCCCGGAGAAGCCTGAGGG - Intronic
1173098294 20:40059627-40059649 CAGAGGCTGGAGCAGTTTGGAGG + Intergenic
1173296832 20:41767096-41767118 CAGGGCCTGTTCAAGGCTGGTGG + Intergenic
1173566036 20:44039309-44039331 AAGGGGCTGGAGAGGTCAGGAGG + Intronic
1173576086 20:44113679-44113701 CAGGGCCAGGAGAGGCCTCGGGG - Intronic
1173878047 20:46388762-46388784 TAGGGGCTAGAGAAGTCAGGAGG - Intronic
1175087690 20:56473955-56473977 CAGGGAATGGAGAATACTGGAGG + Intronic
1175199906 20:57269705-57269727 GAGGGCCTGGTGCAGTCTTGGGG - Intergenic
1175837280 20:62004164-62004186 CAGGGCCTGGAGGGGGCGGGTGG + Intronic
1176122364 20:63459923-63459945 CATGGACTGGAGGAGTCTGGAGG - Intronic
1179450050 21:41462187-41462209 CAGAGGCTGGAACAGTCTGGAGG + Intergenic
1179495912 21:41771219-41771241 CAGGGGCTGGAGATGGCTGAGGG - Intergenic
1179728855 21:43356120-43356142 CAGGCCCTGCAGCAGCCTGGAGG + Intergenic
1180482514 22:15767397-15767419 CAGGGCATGCAGAACTATGGTGG + Intergenic
1181737319 22:24892176-24892198 CAGGGCTTGGAGGAGTCTCAGGG + Intronic
1181821044 22:25475927-25475949 CAGAGCATGGCGAGGTCTGGAGG + Intergenic
1182429121 22:30289810-30289832 CGGGGCCTGGAGGAGTCAGACGG - Intronic
1182935433 22:34217529-34217551 CAGGGCCTGGATAGATTTGGAGG + Intergenic
1183405999 22:37630986-37631008 CACGGTGTGGAGAAGGCTGGTGG - Exonic
1183717205 22:39540422-39540444 CAGGGCCTGAGGAGGTCAGGGGG + Intergenic
1183743183 22:39679451-39679473 CAGGGGCTGGAGAGGTGTGAGGG + Intronic
1184116737 22:42426754-42426776 CTGGGCCCAGAGAAGCCTGGTGG + Intronic
1184648974 22:45911009-45911031 CAGGGGCTGGACATGTTTGGGGG - Intergenic
1185029209 22:48432766-48432788 AAGGGCCTGGTGAGGGCTGGAGG - Intergenic
1185380651 22:50506248-50506270 CTGGACCTGGGGTAGTCTGGGGG - Intronic
949673409 3:6425380-6425402 CAGGGGTTGGAATAGTCTGGAGG - Intergenic
950102629 3:10367296-10367318 CTGGGCCCAGAGAATTCTGGAGG - Intronic
950610451 3:14123758-14123780 CAGGGCCTGGAGGGGTTAGGTGG + Intronic
950927708 3:16759489-16759511 CAGGGCCTGGGCAAGTCCAGAGG + Intergenic
951312862 3:21150535-21150557 CAGGGCCTGTGGAAGGGTGGGGG - Intergenic
952963098 3:38604903-38604925 GAGGGCCTGGAAAAGAGTGGAGG + Exonic
953381520 3:42476236-42476258 CAGAGGATGGAGAAGTCAGGAGG + Intergenic
953784113 3:45897554-45897576 CGGGGCCTGGAGGAGACTGCAGG - Intronic
954155678 3:48683773-48683795 CAGGGCCAGGGGAGGGCTGGGGG - Intronic
954298667 3:49687716-49687738 CTGGGCCTAGATAAGACTGGGGG - Intronic
954440755 3:50520843-50520865 CAGGGCCTGGAGCAGGATGTAGG - Intergenic
954538074 3:51376157-51376179 CAAGGCCTGCTGAATTCTGGGGG - Intronic
954800770 3:53185845-53185867 CGGGGCCTGGGGTAGGCTGGGGG - Intronic
955935235 3:64096675-64096697 CAGTGCCCGGAGGGGTCTGGAGG - Exonic
957654949 3:83061943-83061965 CAGAGGCTGGAGGAGTTTGGAGG - Intergenic
958893782 3:99808254-99808276 CAGGGCCTGCTGAGGTCAGGTGG - Intergenic
961537437 3:127578723-127578745 AAGGGGCTGGGGAAGCCTGGAGG - Intronic
961853072 3:129840959-129840981 CAGAGGCTGGAAAAGTTTGGAGG + Intronic
962990494 3:140573199-140573221 CAGGGCCTGGCAGAGTGTGGAGG + Exonic
963432195 3:145222545-145222567 AAGGGACAGGAGAAGTCAGGTGG + Intergenic
968949661 4:3683989-3684011 CAGGACCTGGAGAACACAGGCGG - Intergenic
968960771 4:3742402-3742424 CAGGGTATGGATAAATCTGGGGG + Intergenic
969262652 4:6043547-6043569 CAGGCCCTGGAGATGCCTTGAGG - Intronic
969429419 4:7145459-7145481 CCGGGGCTGCAGAAGCCTGGGGG - Intergenic
970747685 4:19319078-19319100 TATGGCCTGGAGACGCCTGGAGG + Intergenic
973882875 4:55291356-55291378 CAGGACCTGGCCAAGTCTGGAGG + Intergenic
974028065 4:56751482-56751504 AATGGCCTGGACAAGTCTGTTGG - Intergenic
974525419 4:63044017-63044039 CAGAGCCTGGAACAGTTTGGAGG - Intergenic
975259234 4:72276673-72276695 CAGCCCCTTGAGAAGTTTGGTGG + Intergenic
976786081 4:88823180-88823202 CATTGCCTGAAGAAGTTTGGAGG - Intronic
977139129 4:93344776-93344798 CAGGAGCTAGAGAAGGCTGGCGG - Intronic
977793535 4:101135057-101135079 CAGGGCCTGTGGAAGGGTGGGGG + Intronic
978740934 4:112137165-112137187 CAGGATCTGGAGAAGTAAGGTGG - Intergenic
979251702 4:118572883-118572905 CGGGGCCAGGAGAAGACAGGAGG + Intergenic
981552066 4:145952049-145952071 AAGGACCTTGAGAGGTCTGGGGG + Intergenic
982117178 4:152107401-152107423 CAGGGCCTGGAGGAGTCCAGTGG + Intergenic
983149310 4:164258235-164258257 CAGGGCCTGTAGCAGGGTGGGGG + Intronic
983320540 4:166191080-166191102 CAGGGGTTGGAAAAGTTTGGAGG + Intergenic
984031749 4:174612838-174612860 CAGGGGTTGGAACAGTCTGGAGG - Intergenic
984912366 4:184686260-184686282 CAGGGCTGGGAGAAGGCTGTGGG + Intronic
985009072 4:185563858-185563880 CAGGGCCAAGAGAACTCTGGAGG - Intergenic
985848506 5:2371665-2371687 CGGGGCCTGGGGAAGGTTGGAGG - Intergenic
985856121 5:2428931-2428953 GAGGTCCTGGAGAATTCTGGAGG - Intergenic
986331735 5:6721516-6721538 GAAAGCCTGGAGAAGTATGGAGG + Intronic
986538226 5:8815062-8815084 CAGAGGCTGGAAAAGTTTGGAGG + Intergenic
987674959 5:21062792-21062814 CAGAGGTTGGAGAAGTTTGGAGG + Intergenic
988172794 5:27681385-27681407 TGGGGCCTGGAGAAGGGTGGGGG + Intergenic
989461455 5:41704158-41704180 CAGGGCCTGTCGGAGGCTGGGGG - Intergenic
992451577 5:76880892-76880914 CAGGGCCTCGGGAATTTTGGAGG + Intronic
992471602 5:77061764-77061786 GAGGGCCTGGGGAAGGATGGTGG + Exonic
993238216 5:85344112-85344134 CAGAGTTTGGAAAAGTCTGGAGG + Intergenic
993745837 5:91595990-91596012 CTGGGCCTGCAGAAGGTTGGGGG - Intergenic
995591704 5:113706490-113706512 CAAAGACTGGAGAAGTTTGGAGG - Intergenic
995734221 5:115281390-115281412 CAGCCTCTGGAGAAGTGTGGTGG - Intronic
996687351 5:126297360-126297382 CTGGGCCTGTTGAAGTCTGAGGG + Intergenic
997009864 5:129863104-129863126 TAGGGCCTGGAGAAGGGAGGTGG + Intergenic
997146604 5:131440917-131440939 CAGGGCCTGGACTAGTTTGGTGG - Intronic
998324029 5:141262793-141262815 CAGGGCCTTGAGAAGTATTATGG - Intergenic
1000209773 5:159098370-159098392 CAGGGGCTGGAGAAGACTTTTGG + Intronic
1000701662 5:164458339-164458361 CAGGCCCAGGAGAACTGTGGAGG - Intergenic
1000857469 5:166417260-166417282 CAGGGCCTGCTGAAGTCTGAGGG - Intergenic
1001041376 5:168337965-168337987 CAGGACCTGGAGGAGGCTGGAGG + Intronic
1001412440 5:171520698-171520720 CAGGGCACGCAGGAGTCTGGGGG - Intergenic
1001530376 5:172456934-172456956 CAAGGCCTGGAGGAGGTTGGGGG - Intergenic
1001604154 5:172948143-172948165 CAGGGAGTGGAGAGGACTGGGGG - Intronic
1002419278 5:179137290-179137312 CAGGGACCTGAGGAGTCTGGTGG - Intronic
1003130546 6:3391852-3391874 CCAGGCCTGCAGAGGTCTGGAGG + Intronic
1003328248 6:5108993-5109015 CAAGGCCTGGAGAGGGCTGTTGG - Exonic
1003759650 6:9162249-9162271 AAGGCCCTGGAGAAGACTGGTGG + Intergenic
1004051262 6:12081880-12081902 CAGGGTATGGGGAAGCCTGGAGG - Intronic
1004273122 6:14212310-14212332 TAGGGGCTGGAGTAGGCTGGGGG - Intergenic
1005215720 6:23525679-23525701 CAGGGCCTGGAGAATTTTAAGGG + Intergenic
1006121680 6:31810744-31810766 CTGGGGCTGGAGACGGCTGGGGG - Exonic
1006510028 6:34516575-34516597 CAGGGGCTGGTGAGGCCTGGAGG + Intronic
1007468054 6:42068999-42069021 CAAGGCATGGACATGTCTGGGGG + Intronic
1008104768 6:47429556-47429578 CAGAGGTTGGAAAAGTCTGGAGG - Intergenic
1008681557 6:53877830-53877852 CGGAGGCTGGAGCAGTCTGGAGG - Intronic
1010370597 6:75102632-75102654 GAGGGCCTGGAGGACCCTGGGGG + Exonic
1012491501 6:99787619-99787641 CAGGGCCTGGAGAAGTGTCCAGG + Intergenic
1013249991 6:108324568-108324590 CAAAGACTGGAGAAGTGTGGAGG - Intronic
1015156432 6:130101607-130101629 CAGGGCCTGGAAAGGGCAGGGGG + Intronic
1015903583 6:138092896-138092918 AAGGGCATGGGGAAGTGTGGTGG + Intronic
1016148002 6:140700688-140700710 CAGGGCCTGTTGAAGGGTGGGGG - Intergenic
1016579616 6:145615571-145615593 CAGGGGCTGGAACAGTTTGGAGG + Intronic
1016781654 6:147965775-147965797 CAGGGCCTGTAGGGGGCTGGGGG + Intergenic
1017493012 6:154960394-154960416 CAGGACCTGGAGAGGACAGGCGG - Intronic
1017716884 6:157219018-157219040 CAGGAGCTTGAGAAGTCTTGAGG - Intergenic
1018812424 6:167307712-167307734 CATGGCCTGGAGGGGCCTGGAGG - Intronic
1019023143 6:168935826-168935848 CAGGGCCTGGAGCAGGAGGGAGG - Intergenic
1019305887 7:335592-335614 CAGGGCCTGGGGACCTCTGGAGG - Intergenic
1019484685 7:1284119-1284141 CAGGGTCTGCAGAAGTCCCGGGG + Intergenic
1020096782 7:5374062-5374084 CAGGGCCTGGAAGGGGCTGGGGG + Exonic
1020241976 7:6402126-6402148 CAGGGCCTGGTGTACTCTTGGGG + Intronic
1021663182 7:22942524-22942546 AACGGCCTGGAGTATTCTGGTGG - Exonic
1021840642 7:24719078-24719100 CAGGTCGAGGAGAAGTGTGGTGG - Exonic
1023177176 7:37446653-37446675 CAGGGCCTGGAGCAGTCATTGGG - Intronic
1023406799 7:39842341-39842363 CAGAGGCTGGAATAGTCTGGAGG + Intergenic
1023632825 7:42180560-42180582 GATGGCCTGGAAAAGGCTGGAGG + Intronic
1023995535 7:45157299-45157321 GATGGCCTAGAGGAGTCTGGGGG - Intergenic
1024414249 7:49083605-49083627 CAGGGCCTGTAGGAGGGTGGGGG + Intergenic
1024666201 7:51549733-51549755 CCGGGCCTGGAGAAGTGGAGAGG + Intergenic
1026106130 7:67422242-67422264 CATGGCCTGTGGAAGGCTGGAGG - Intergenic
1026194204 7:68158431-68158453 CAGGGCATGGACAATACTGGAGG - Intergenic
1026233899 7:68509533-68509555 CTGGGGCTGGAACAGTCTGGGGG - Intergenic
1026808072 7:73440225-73440247 CAGGGCCAGGAGAGGCTTGGAGG + Intergenic
1027184624 7:75963543-75963565 CAGGGCCCAGTGAAGTCAGGAGG - Intronic
1029148641 7:98464726-98464748 CAGGGCCTGGAGACAGCTGTGGG + Intergenic
1029490775 7:100868739-100868761 CAGGCCGAGGTGAAGTCTGGGGG + Exonic
1029715283 7:102322160-102322182 CAGGGCAGGAAGAAGCCTGGCGG + Intergenic
1029715293 7:102322197-102322219 CAGGGCAGGAAGAAGCCTGGCGG + Intergenic
1029715303 7:102322234-102322256 CAGGGCAGGAAGAAGCCTGGCGG + Intergenic
1030640803 7:112004047-112004069 CAGATCCTGGAGAAGTGTGATGG - Exonic
1031115188 7:117659545-117659567 CAGAGCCTTGAGATGTCTGAGGG + Intronic
1032189761 7:129757884-129757906 CAGGGCATGCAGAAGCATGGAGG - Intergenic
1032497444 7:132373318-132373340 CAAGGTCTGGAGAAGTCAAGAGG + Intronic
1033433451 7:141310579-141310601 CAGGGCCTGTTGAAGGGTGGGGG - Intronic
1034261475 7:149759345-149759367 CATGGGCTGGAGCAGTCAGGGGG - Intergenic
1034493895 7:151409231-151409253 CAGGGCAGGGTGAGGTCTGGGGG - Intronic
1034540426 7:151754797-151754819 TAGGGCCTGGAGAAGTGCTGGGG - Intronic
1034544124 7:151778546-151778568 CAGGGCTTGGAGAAGGCATGGGG - Intronic
1034570330 7:151950617-151950639 CACAGCCTGGGGAAGTCTAGTGG - Intergenic
1034978465 7:155461181-155461203 CTGTGGCTGGAGAAGGCTGGGGG - Intronic
1035547801 8:497151-497173 CAGAGGCTGGAATAGTCTGGAGG + Intronic
1037155674 8:15695598-15695620 CAGAGTCTGGAAAAGTTTGGGGG + Intronic
1037780518 8:21865329-21865351 CAGGGCCTGGACCAGTCATGTGG - Intergenic
1038703214 8:29870722-29870744 GCAGGACTGGAGAAGTCTGGGGG + Intergenic
1039439341 8:37584093-37584115 TAGGTCCTAGAGAAGTTTGGGGG - Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1043039573 8:75244357-75244379 CAAGGCCTGGAGAAGGCTGGAGG + Intergenic
1043384338 8:79733108-79733130 CAGAGGCTGGAAAAGTTTGGAGG - Intergenic
1044526654 8:93260120-93260142 CAGGACCTGGATATCTCTGGGGG + Intergenic
1045239258 8:100384599-100384621 CAGAGCCTGGGGAAGCCTGGCGG - Intronic
1046200975 8:110927238-110927260 CAGGGCACGGTGCAGTCTGGTGG + Intergenic
1048119409 8:131563224-131563246 CATGGCATGGGGAAGACTGGGGG + Intergenic
1048425540 8:134319727-134319749 CAGTGCCTGGAGAGGTGTCGTGG + Intergenic
1049408743 8:142463185-142463207 CAGGGCCTGGGGAGGGATGGAGG - Intronic
1049587954 8:143440643-143440665 CAGCCCCGGGAGGAGTCTGGGGG - Intronic
1049685163 8:143936422-143936444 CCAGGCCTGGAAAAGGCTGGGGG + Intronic
1049757077 8:144315495-144315517 CAGGGCCTGGTCCAGTCTTGGGG + Exonic
1053101439 9:35375067-35375089 CAAGGGCTGGCAAAGTCTGGGGG - Intronic
1053667152 9:40324467-40324489 CAGGGGCTGGAGGATTCTGGAGG - Intronic
1053916742 9:42949578-42949600 CGGGGGCTGGAGGATTCTGGAGG - Intergenic
1054378298 9:64464495-64464517 CAGGGGCTGGAGGATTCTGGAGG - Intergenic
1054517458 9:66051816-66051838 CAGGGGCTGGAGGATTCTGGAGG + Intergenic
1054903430 9:70393181-70393203 TAGGCCCAGGAGAATTCTGGAGG - Intronic
1057882931 9:98807227-98807249 CTGGGCCTGCAGAAGTCAGTGGG + Intergenic
1060205993 9:121683174-121683196 CAGGGCCTGGGGAAGCTGGGTGG - Intronic
1060923064 9:127436262-127436284 CAGGGCCAGGAGGTGTTTGGGGG + Intronic
1061520505 9:131114780-131114802 AAGGGTCTGGAGGAGTCTGAGGG - Intronic
1061943578 9:133895628-133895650 CAGGGGCTGGGGAAATTTGGGGG + Intronic
1062138818 9:134944280-134944302 CAGCCCCTGGAGAAAGCTGGAGG - Intergenic
1062276942 9:135735751-135735773 CAGAGCGTGGACAAGTCCGGAGG + Intronic
1062525065 9:136974883-136974905 CAGGTCATGGACAAGCCTGGTGG - Intergenic
1186546953 X:10459986-10460008 CAGGGCAGGGAGAATTTTGGAGG - Intronic
1189226908 X:39420635-39420657 CAGGGCCTGGAATATTATGGGGG - Intergenic
1189233454 X:39470036-39470058 CAGGACCTGGGAAAGGCTGGTGG - Intergenic
1189267554 X:39728534-39728556 CAGGGGCTGGAATCGTCTGGAGG + Intergenic
1190318147 X:49164200-49164222 CAGGGCCTGGAGAGTGCTTGGGG + Intronic
1191775170 X:64805979-64806001 CTGGGCCAGGAAAAATCTGGAGG + Intergenic
1192510302 X:71717266-71717288 CAGGGCCTGGGGAAAGGTGGAGG - Exonic
1192516395 X:71764287-71764309 CAGGGCCTGGGGAAAGGTGGAGG + Exonic
1192529423 X:71872407-71872429 CAGGGCCTGGGGAAAGGTGGAGG - Intergenic
1193436317 X:81478521-81478543 CAGGCTATGGACAAGTCTGGCGG - Intergenic
1195059282 X:101178043-101178065 CAGGGCCTGAAAGAGTCTAGGGG + Intergenic
1195228777 X:102824858-102824880 TAGGGCCTGGAAGAGTTTGGAGG - Intergenic
1195273309 X:103254343-103254365 GAGGGCCTGGGAAAGTCTGAAGG - Intronic
1197472585 X:126881777-126881799 CAGAGGTTGGAAAAGTCTGGAGG + Intergenic
1197643564 X:128993157-128993179 CAGGGCAGGGTGCAGTCTGGTGG + Intergenic
1197890225 X:131262909-131262931 TGGGGCCTGGAGAAGTCACGAGG - Intergenic
1197891875 X:131277062-131277084 CAGGTCCTGGGCAAGTCCGGGGG - Exonic
1199675642 X:150186981-150187003 CAGGTCCTGCAGAACTCTGGGGG + Intergenic
1200124692 X:153807730-153807752 CAGGGCCTGGATAACTCCTGGGG - Intronic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic
1201274747 Y:12286858-12286880 CTGGGCCGGGAGAAGTCGGCAGG + Intergenic
1201377169 Y:13335177-13335199 CAGGGCCTGTCAAAGGCTGGGGG + Intronic