ID: 1077280591

View in Genome Browser
Species Human (GRCh38)
Location 11:1743354-1743376
Sequence GAGGATGGACAGATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2353
Summary {0: 2, 1: 2, 2: 30, 3: 248, 4: 2071}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077280591 Original CRISPR GAGGATGGACAGATGGAGGA TGG Intronic
Too many off-targets to display for this crispr