ID: 1077282567

View in Genome Browser
Species Human (GRCh38)
Location 11:1752336-1752358
Sequence ACCTGGGGCCATTTATTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077282552_1077282567 20 Left 1077282552 11:1752293-1752315 CCTGGGAGGCAAGAAGGCCCAGC 0: 1
1: 0
2: 5
3: 33
4: 345
Right 1077282567 11:1752336-1752358 ACCTGGGGCCATTTATTTCCCGG 0: 1
1: 0
2: 0
3: 10
4: 129
1077282555_1077282567 2 Left 1077282555 11:1752311-1752333 CCAGCTAGGCCAGCCCCCCCACG 0: 1
1: 0
2: 2
3: 14
4: 268
Right 1077282567 11:1752336-1752358 ACCTGGGGCCATTTATTTCCCGG 0: 1
1: 0
2: 0
3: 10
4: 129
1077282554_1077282567 3 Left 1077282554 11:1752310-1752332 CCCAGCTAGGCCAGCCCCCCCAC 0: 1
1: 0
2: 5
3: 24
4: 343
Right 1077282567 11:1752336-1752358 ACCTGGGGCCATTTATTTCCCGG 0: 1
1: 0
2: 0
3: 10
4: 129
1077282557_1077282567 -7 Left 1077282557 11:1752320-1752342 CCAGCCCCCCCACGCCACCTGGG 0: 1
1: 0
2: 3
3: 39
4: 612
Right 1077282567 11:1752336-1752358 ACCTGGGGCCATTTATTTCCCGG 0: 1
1: 0
2: 0
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077282567 Original CRISPR ACCTGGGGCCATTTATTTCC CGG Intronic
900290132 1:1920249-1920271 GCCTGGGGCCATTTCTTCCAGGG + Intergenic
901922456 1:12547006-12547028 AACTGGGTCCATTTGTTTCATGG + Intergenic
908776688 1:67647479-67647501 ACCTGGGGGCATTTGTGTGCTGG - Intergenic
910658064 1:89638776-89638798 ACCTGTATCCTTTTATTTCCTGG + Intronic
912524735 1:110273115-110273137 TCCTGGGTCCATTTTTCTCCAGG - Intronic
912987543 1:114449837-114449859 ACATGGTTCCATTTTTTTCCTGG + Intronic
913064542 1:115238499-115238521 ACCTGAGGCCCTTCAGTTCCTGG + Intergenic
913083296 1:115409990-115410012 ACTTGGAGCTATTTACTTCCTGG + Intergenic
913456570 1:119037912-119037934 ATCTGGGGCCATCTATTTAGAGG - Intronic
916195441 1:162218083-162218105 ACCTGGGGCCTTTCTCTTCCTGG + Intronic
916252624 1:162753733-162753755 TCCTGGGGCGATTGATTTCAGGG + Intronic
920252420 1:204630586-204630608 AGCTGCAGCCATTTATCTCCGGG - Intronic
920810944 1:209285026-209285048 TCCTGTTTCCATTTATTTCCTGG + Intergenic
923509686 1:234639540-234639562 AATGGGGGTCATTTATTTCCAGG + Intergenic
1063158325 10:3399960-3399982 CCCTGGGGCTATTTCCTTCCTGG + Intergenic
1065087475 10:22193796-22193818 GCTTGGGGCAATATATTTCCAGG + Intergenic
1067146252 10:43695809-43695831 ACAAGGGGCCCTTTTTTTCCCGG + Intergenic
1069793576 10:71038947-71038969 CCCTGGGGCCAGTGATATCCAGG - Intergenic
1071918655 10:90325131-90325153 ACATGGGGCCTTTTATTTGGGGG - Intergenic
1073068182 10:100776532-100776554 ACTGGAGGACATTTATTTCCAGG - Intronic
1077282567 11:1752336-1752358 ACCTGGGGCCATTTATTTCCCGG + Intronic
1078826561 11:14935652-14935674 AGCTGGGGCCACTGATTTCCTGG - Intronic
1080262431 11:30364161-30364183 ACCTGGGACCATTCACTTGCAGG + Intergenic
1087243198 11:95803623-95803645 ACCTGGGTCTATTTATTGCTTGG - Intronic
1087847636 11:102991251-102991273 ACCTTGAGCCATGTTTTTCCTGG - Intergenic
1088625884 11:111730212-111730234 ATCTGGGGTCATATGTTTCCAGG - Exonic
1089147035 11:116336616-116336638 CCATGGAGCCATTTATCTCCTGG + Intergenic
1093258176 12:16898935-16898957 ACATGGAGACATTTATTTCATGG - Intergenic
1095046260 12:37510491-37510513 ACCTTGAGCCATTAACTTCCTGG - Intergenic
1095496735 12:42792677-42792699 ACCCTGGGGCATGTATTTCCAGG + Intergenic
1095916168 12:47481110-47481132 CCCTAGGGTCATTTATCTCCAGG - Intergenic
1096146915 12:49284778-49284800 ACCTGGGACCATATCCTTCCTGG + Intergenic
1099627562 12:85094250-85094272 AAATGGGGCCATCTATTTGCAGG + Intronic
1099734789 12:86553279-86553301 ACCTTGGGCCATTTCTTTTTAGG + Intronic
1100230857 12:92605531-92605553 ACATGGGGCCATCTAGTTGCAGG + Intergenic
1100349467 12:93765454-93765476 ACCTGAGGTCATCTGTTTCCTGG + Intronic
1101545318 12:105706836-105706858 ACCTGCTGCCATTCTTTTCCAGG - Intergenic
1101749488 12:107571689-107571711 TCCCAGGGCCATTTATATCCTGG + Intronic
1102003883 12:109576230-109576252 GCCAGGGGCCAGCTATTTCCCGG + Intronic
1102226120 12:111229473-111229495 ACCTGGGCCCATCTTTCTCCTGG - Intronic
1104967736 12:132516721-132516743 ACCTTGGGCAAGTTATTTACAGG - Intronic
1108049771 13:46421588-46421610 ACCTGTGGCCCTTTACGTCCTGG + Intronic
1108696268 13:52905101-52905123 TCCTGACTCCATTTATTTCCAGG + Intergenic
1108733878 13:53262218-53262240 ACCTGAAGCCAGTCATTTCCAGG - Intergenic
1109940297 13:69353674-69353696 ACCTGGGGTTATTTATTTACAGG - Intergenic
1112345164 13:98583278-98583300 TACTGAGGCCATTTGTTTCCTGG + Intergenic
1114405591 14:22453144-22453166 ACCTGGAGCCATTTTCTCCCAGG + Intergenic
1117869378 14:60183999-60184021 ATCTGGTCCCCTTTATTTCCTGG + Intergenic
1122959266 14:105087203-105087225 ACCTGGGGCCTTTGTTTCCCAGG + Intergenic
1125741680 15:41969624-41969646 ACCTGGGGCCAGGGATTTTCTGG + Intronic
1126288845 15:47048051-47048073 ACCTTGAGCCATTAACTTCCTGG + Intergenic
1127967041 15:63930197-63930219 ACCTGAGGCCAGTTAGCTCCTGG - Intronic
1129180528 15:73871745-73871767 ACATGTGTCCATTTTTTTCCAGG - Intergenic
1129680929 15:77657985-77658007 AGCTTGGGCCATCTGTTTCCCGG + Intronic
1132785559 16:1655446-1655468 ACCTGGAGCCCCTTATTCCCTGG + Intronic
1133484445 16:6205564-6205586 ACCTGGTGCTATTTAATTCAGGG - Intronic
1136123091 16:28153873-28153895 ACATGGGACATTTTATTTCCGGG - Intronic
1136548807 16:30970748-30970770 ACCATGGGCCGTTTATCTCCTGG + Intronic
1138571049 16:57873413-57873435 ACCTGGGGCTATCTCGTTCCGGG + Intergenic
1139900526 16:70324667-70324689 ACCTGGGGGTATTTGTTTGCAGG - Exonic
1140726724 16:77820153-77820175 ATCTGAGGCCATTTCTTTCATGG + Intronic
1145385626 17:22409728-22409750 GCCTGGGGGCATGTATTTCTCGG + Intergenic
1146352146 17:32103839-32103861 AACTGGGGCCTTTTCCTTCCTGG - Intergenic
1146725675 17:35153898-35153920 ACCTGGAGCCTTTTATTTTAAGG + Intronic
1148204843 17:45773797-45773819 ACCAGGGGCCATTCATTCCTTGG - Intergenic
1149869655 17:60170211-60170233 AACTGGGGCCTTTTCCTTCCTGG - Intronic
1150205429 17:63401822-63401844 TTTTGGGGCCATGTATTTCCAGG - Intronic
1153636061 18:7114827-7114849 TTCTGGGACCATTTATTTCAGGG - Intronic
1159671370 18:71225124-71225146 ACTTGGAGCCATGTATTTTCTGG + Intergenic
1159816884 18:73085420-73085442 ACCTCAGGCTATTTAGTTCCAGG + Intergenic
927479040 2:23435829-23435851 GCCTGGGGCCATTCATTGCTGGG - Intronic
929768256 2:44868966-44868988 GCCTGTGGCCATCTATATCCCGG + Intergenic
929850881 2:45589346-45589368 ACATGGTGCCACTTATTGCCTGG - Intronic
930897276 2:56460997-56461019 ACCTGGGGCCATTCAGTTGGTGG - Intergenic
932458263 2:71863793-71863815 ACCTGGGGCTGTGTACTTCCAGG + Intergenic
933646799 2:84819750-84819772 ACCTGGGGCCTTTCATATCAGGG - Intergenic
933858521 2:86441685-86441707 ACCAGGGGCCTTTTCTTTTCGGG + Intronic
937395855 2:121534144-121534166 CCCTGGGGCCATTTATACACTGG + Intronic
937953999 2:127408783-127408805 ACCTGGGGCGACTTATTTCATGG + Intergenic
942877655 2:180820906-180820928 TCCTGGGCCCTTTTATTCCCTGG - Intergenic
944530797 2:200665801-200665823 AGCTGAGGCCACTTATCTCCTGG + Intronic
945012139 2:205476590-205476612 ACCTGTGGCCCTTTGTTTTCTGG + Intronic
947660615 2:231863800-231863822 ACCTAGGTCCATTAATTTACTGG + Intergenic
1169923398 20:10758480-10758502 TCCAGGGGCCATTAACTTCCTGG - Intergenic
1173012643 20:39196145-39196167 TCCTGGAGCCAGTTATATCCAGG + Intergenic
1173051414 20:39565753-39565775 ACCTAAGGCCACATATTTCCTGG + Intergenic
1176095825 20:63343907-63343929 TCCTAGGGCCAGTTAGTTCCCGG - Intronic
1183322855 22:37175792-37175814 CCCTGGGGCCATTTCTTCCCTGG - Intergenic
949244220 3:1906448-1906470 TCCTGGGGACATTCATTTCCTGG - Intergenic
949419062 3:3845848-3845870 ACCTGGTGCCCTTTATATTCGGG - Exonic
950872671 3:16243119-16243141 ACCCGGGGCCATTCACTCCCTGG + Intergenic
952826704 3:37530501-37530523 CCCTGGGGCCACCTATCTCCAGG - Intronic
952874881 3:37936253-37936275 CCCTGGGGACATTTATCTCATGG + Intronic
957363339 3:79187622-79187644 TCCTGGGGCCATCTGTTTTCTGG - Intronic
958573251 3:95913481-95913503 ACCTGTGTCCATTACTTTCCTGG - Intergenic
959657486 3:108825665-108825687 ACTTGGGGACATTTATTTCTTGG - Intronic
960811202 3:121629055-121629077 ATCTGGGTGCTTTTATTTCCTGG + Exonic
962456234 3:135568034-135568056 ACCTGGAGCCATTTCCTCCCTGG + Intergenic
963028521 3:140942693-140942715 ACCTCGGGCCGCTCATTTCCGGG + Intronic
963901733 3:150739582-150739604 ACCTGGGGATTTTTATTTTCTGG + Intergenic
969832341 4:9807926-9807948 GCCTGGGGCCAACTATTTCAGGG - Intronic
970234112 4:13940969-13940991 TCCTGAGGCCTTTTCTTTCCTGG - Intergenic
975690963 4:76962931-76962953 AGCTGGGACCACTTAGTTCCTGG + Intronic
980625645 4:135371748-135371770 ACTTGGGGGCATCTACTTCCAGG + Intergenic
983948811 4:173616489-173616511 ACCTGGGCCCTTTTCTTTCGAGG + Intergenic
987324387 5:16799433-16799455 ACCTGTGGACATTGATTTCTGGG - Intronic
988486954 5:31675181-31675203 AAGTGGGACCATTTATTTCTGGG + Intronic
991002296 5:61794513-61794535 ACCTGGGTTCATATATTTACTGG - Intergenic
992682571 5:79167587-79167609 AGCTGGGCCCATCTCTTTCCTGG + Intronic
996306822 5:122056567-122056589 ACCTGGAGCTATTTATTGCTTGG + Intronic
996400725 5:123059359-123059381 ACTTGGAGCATTTTATTTCCTGG + Intergenic
1000178174 5:158778880-158778902 ACCTGGAGCCATTTAGTACAGGG - Intronic
1001098343 5:168793844-168793866 ACCTCGGGCCATTAATCTCCTGG - Intronic
1001685985 5:173595490-173595512 ATTTGGGGCTATTTATCTCCCGG + Intergenic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1005893527 6:30159323-30159345 TCCTGGGGCCATTTCATTCCTGG - Intronic
1006094517 6:31647589-31647611 ACTTGGGTGCATTTGTTTCCGGG + Exonic
1010496785 6:76542887-76542909 CCATGGGCCCATTTATTTTCAGG - Intergenic
1016315816 6:142785395-142785417 ACCTTGGCCCATTTATGTCTTGG - Intronic
1023482328 7:40647122-40647144 ACCTGTGGCCATTTTTTACTGGG + Intronic
1023610797 7:41968299-41968321 AACAGGGACCATTTATTTCAGGG + Intronic
1025292253 7:57740341-57740363 ACCTTGAGCCATTAACTTCCTGG - Intergenic
1026683341 7:72487358-72487380 AGCTGGGGAGTTTTATTTCCTGG - Intergenic
1033417709 7:141178691-141178713 ACCTGGGGCCATTCAGTGCAGGG - Intronic
1038239357 8:25793919-25793941 ACCTGGGGCCATGTGATTCTGGG + Intergenic
1038268326 8:26053283-26053305 ACTTGGGGCCATCTACCTCCCGG - Intergenic
1043502091 8:80868428-80868450 TCATGTGCCCATTTATTTCCAGG - Intronic
1044288728 8:90441980-90442002 AGCTGGGGACATTTTTTACCAGG + Intergenic
1045301913 8:100918554-100918576 ACCTTGGGGTCTTTATTTCCAGG - Exonic
1052923066 9:33988564-33988586 GCCAGGGGCCATTTAGTTACAGG - Intronic
1053217915 9:36288256-36288278 GCCTCTGGCCATTGATTTCCAGG - Intronic
1054164244 9:61705367-61705389 ACCTGGAGCCATTAACTTCCTGG + Intergenic
1057179713 9:93023188-93023210 ATCTGGGGCCATGTCATTCCTGG - Intronic
1187710510 X:22048900-22048922 AACTGGGGATATTTCTTTCCAGG + Intronic
1189560370 X:42185791-42185813 ACCTGAAGCCTCTTATTTCCAGG - Intergenic
1193358897 X:80556621-80556643 ACCTGAGGCCCTTTGTCTCCTGG - Intergenic
1194225592 X:91252990-91253012 AGCTGCAGCCATTTATTTGCAGG - Intergenic
1198973049 X:142302978-142303000 ACCTGGGGCCATTTGTGCCATGG + Intergenic
1199410334 X:147514667-147514689 ACCTGGGGCCTTCTTTTTCCTGG - Intergenic
1200562131 Y:4717883-4717905 AGCTGCAGCCATTTATTTGCAGG - Intergenic