ID: 1077282693

View in Genome Browser
Species Human (GRCh38)
Location 11:1752831-1752853
Sequence GGTCAGCTGCAGAGGAAGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 0, 2: 12, 3: 55, 4: 476}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077282687_1077282693 0 Left 1077282687 11:1752808-1752830 CCGCCCAAGGGGAGGACAACAGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1077282693 11:1752831-1752853 GGTCAGCTGCAGAGGAAGGCTGG 0: 1
1: 0
2: 12
3: 55
4: 476
1077282689_1077282693 -3 Left 1077282689 11:1752811-1752833 CCCAAGGGGAGGACAACAGAGGT 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1077282693 11:1752831-1752853 GGTCAGCTGCAGAGGAAGGCTGG 0: 1
1: 0
2: 12
3: 55
4: 476
1077282690_1077282693 -4 Left 1077282690 11:1752812-1752834 CCAAGGGGAGGACAACAGAGGTC 0: 1
1: 0
2: 1
3: 14
4: 142
Right 1077282693 11:1752831-1752853 GGTCAGCTGCAGAGGAAGGCTGG 0: 1
1: 0
2: 12
3: 55
4: 476
1077282682_1077282693 22 Left 1077282682 11:1752786-1752808 CCATGTCAGCTGGGGCTCTCAGC 0: 1
1: 1
2: 2
3: 15
4: 221
Right 1077282693 11:1752831-1752853 GGTCAGCTGCAGAGGAAGGCTGG 0: 1
1: 0
2: 12
3: 55
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077282693 Original CRISPR GGTCAGCTGCAGAGGAAGGC TGG Exonic
900031131 1:373875-373897 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900031141 1:373914-373936 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051698 1:602124-602146 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051708 1:602163-602185 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900080745 1:855636-855658 TGGCACCTGCAAAGGAAGGCTGG + Intergenic
900120935 1:1048373-1048395 TGTCCACTGCAGAGGAGGGCGGG + Intronic
900310989 1:2033028-2033050 GGGCAGGAGCAGATGAAGGCGGG + Intergenic
902538655 1:17136700-17136722 GGTAGGCAGCAGGGGAAGGCGGG + Intergenic
902744694 1:18465835-18465857 GGGAAGCTGCAGAGGATGGTGGG - Intergenic
902749283 1:18495899-18495921 GGTTAGGGGCAGAGGCAGGCCGG - Intergenic
903086632 1:20866240-20866262 GGTCAGCTGTTGATCAAGGCTGG + Intronic
903605470 1:24572369-24572391 GGTCAGAGGCACAGGAAGGAAGG - Intronic
903778748 1:25808896-25808918 GGGCAGGTCCAGAGGAAGGCAGG - Intronic
904034194 1:27550303-27550325 CGTCTGCTGCATAGGATGGCTGG + Exonic
904279578 1:29409433-29409455 GGTCACCTGGAGAGGAGGGAGGG + Intergenic
904875052 1:33648052-33648074 GATCAGCTGCAGACAAAAGCAGG + Intronic
904950547 1:34234835-34234857 TGGCAGTTGCACAGGAAGGCAGG + Intergenic
905882051 1:41470344-41470366 GGTCAGCTGACAAGGAAGACAGG + Intergenic
906103698 1:43279248-43279270 GGCCAGGGGCAGAGGCAGGCGGG + Intergenic
906322737 1:44827077-44827099 GGTCAGCTGCAGAGGCAGAGAGG + Exonic
906760806 1:48376161-48376183 GGTCAGATGGAAAGGAAAGCAGG - Intronic
908355503 1:63322717-63322739 GGCCAGAGGCCGAGGAAGGCGGG + Intergenic
908823977 1:68115992-68116014 GGACAGCTGCAGGGGAGAGCTGG - Intronic
909370584 1:74878726-74878748 GGGCAGCTGGAGAGAAAGGTCGG + Intergenic
910010503 1:82455447-82455469 TGTCACCTGCAGAGAGAGGCTGG + Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
912435937 1:109661110-109661132 GGTCAGCTGCCCATGAGGGCTGG - Intronic
912437879 1:109674692-109674714 GGTCAGCTGCCCATGAGGGCTGG - Intronic
912440390 1:109693151-109693173 GGTCAGCTGCCCATGAGGGCTGG - Intronic
912493866 1:110078753-110078775 GGGCAGATGGAGAGGCAGGCAGG + Intergenic
912587254 1:110778355-110778377 TGTCATCTGAAGAGGTAGGCAGG + Intergenic
912643484 1:111369402-111369424 GCACAGCTGTAGAGGAAGGACGG + Intergenic
912704181 1:111899727-111899749 GGGCAGTTGCAAAGGAAGGCAGG + Intronic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
913371383 1:118103435-118103457 CCTCTGCTGCTGAGGAAGGCTGG - Intronic
913522394 1:119657399-119657421 GGCCAGGTACAGAGGAAGGAGGG + Intergenic
915107331 1:153542617-153542639 GGTCAGGTGCAGAGGCTGGAGGG - Intergenic
915282939 1:154835020-154835042 GGTCAGCCACCGAGGAAGCCAGG + Intronic
915291641 1:154888146-154888168 GGCCAGCTGAAGAAGATGGCAGG - Intergenic
915733098 1:158067853-158067875 GGCCAGCTGCAGCGGCTGGCTGG - Intronic
916653517 1:166852116-166852138 GGTCAGCAGAAAAGGGAGGCTGG - Exonic
916673976 1:167050704-167050726 GGTCAGGTGGACAGAAAGGCTGG + Intergenic
918048468 1:180955018-180955040 GGTGAGCTGCAGAGGGACCCAGG - Intergenic
918111112 1:181456211-181456233 GTTCAGCCTCACAGGAAGGCTGG + Intronic
918243117 1:182637352-182637374 GGTCTGCTACAGATGAAGGTAGG - Intergenic
920118667 1:203639144-203639166 AGTCAGCTGCTAAGGAAGGATGG - Intronic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920682495 1:208083651-208083673 GGTCAGCTGGAGATGAGGGAGGG - Intronic
920735581 1:208530224-208530246 GATCAGATGATGAGGAAGGCTGG + Intergenic
921420697 1:214944376-214944398 GGTCTGCTTCAGAGGAAGGTCGG + Intergenic
921512178 1:216045740-216045762 GCTCAGATGCAGAGGAGGCCTGG - Intronic
922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG + Intergenic
922427947 1:225517301-225517323 GGGCAGCTGCAGAGGGAGAAGGG + Exonic
924643784 1:245858155-245858177 GGGGAGCTGTAGAGGAACGCAGG - Intronic
924902403 1:248415168-248415190 GGTCATCTGCAGGGGAATGTGGG + Intergenic
924939746 1:248804752-248804774 GGTGGGCTGCAGAGGCAGGTGGG + Intergenic
1064205088 10:13316550-13316572 GGAATGTTGCAGAGGAAGGCAGG - Intergenic
1065443833 10:25777012-25777034 GGAAAGCTGCAAAGGAACGCAGG + Intergenic
1065915941 10:30355110-30355132 AGGAAGCTGCAGAGGCAGGCAGG + Intronic
1067078007 10:43199007-43199029 TGCCAGCTGCAGAGGACAGCAGG + Exonic
1067084165 10:43229435-43229457 GGGCAGGAGCAGAGGCAGGCTGG + Intronic
1069466735 10:68646629-68646651 GGTTAGGTGGAGAGGAGGGCTGG - Exonic
1069943617 10:71971570-71971592 AGGCAGCTGGAGAGGAAGGGAGG - Intronic
1070452758 10:76578595-76578617 TGTTAGCTGCAGGAGAAGGCTGG + Intergenic
1070598487 10:77849368-77849390 GGCCAGCAGCAGAGGAAGCGGGG - Intronic
1070761657 10:79027865-79027887 GCTCAGCTTCTGAGGCAGGCAGG - Intergenic
1071508257 10:86245838-86245860 GGTCAGCAGAAGAAGAAGGCTGG + Intronic
1073055850 10:100700746-100700768 GCCCAGTTGCAGAGGAAGCCTGG - Intergenic
1074122444 10:110502925-110502947 AGTCAGGTGCTGAGGAAGGAAGG - Intronic
1076631301 10:131853609-131853631 GGTCCCCTGGAGAGGAAGGTGGG - Intergenic
1076904880 10:133356776-133356798 GGTCACCTGACCAGGAAGGCTGG - Intronic
1077015930 11:399257-399279 GGGCAGGTGGGGAGGAAGGCAGG - Intronic
1077282693 11:1752831-1752853 GGTCAGCTGCAGAGGAAGGCTGG + Exonic
1077466048 11:2734267-2734289 GCCCAGCTGCAGAGCAGGGCAGG + Intronic
1078345163 11:10541273-10541295 GGGGCGCTGCAGAGGAAGGTTGG - Intergenic
1078990552 11:16642321-16642343 GGGCAGCCACAGAGAAAGGCTGG - Intronic
1079010056 11:16820687-16820709 AGTGAGCTGCAGAGCCAGGCAGG - Intronic
1079831918 11:25279731-25279753 GGGCAGCCACAGAGAAAGGCAGG - Intergenic
1081084134 11:38778046-38778068 GGTCTACTGGAGAGGAGGGCAGG + Intergenic
1081650658 11:44821964-44821986 GGTCTGCTTCTGAGGATGGCTGG + Intronic
1081718835 11:45271496-45271518 AGTCAGCTGGAGAGGAAGGCTGG + Intronic
1081758432 11:45560662-45560684 GGACAGCTGCTGAGCATGGCTGG - Intergenic
1082165548 11:48946082-48946104 AGTGGGCTGCAGAGGAACGCCGG + Intergenic
1082732536 11:56817803-56817825 GCTCAGGTGCAGAGGAGGGTGGG + Intergenic
1082834446 11:57641186-57641208 GGCCAGCAGCAGAGGCATGCCGG - Intergenic
1082866190 11:57902051-57902073 CGACAGCTGCAGAGGGAGGAGGG - Intergenic
1083171168 11:60924733-60924755 GGTCAGCGGGAGGGGAGGGCCGG + Exonic
1083373732 11:62202978-62203000 GGTCAGCTCCAGGGGATGTCAGG + Intergenic
1083642054 11:64150878-64150900 GGCCAAAGGCAGAGGAAGGCAGG + Intronic
1083730198 11:64648663-64648685 GGCCAGCTGCAGAGGCAGACCGG - Intronic
1084097538 11:66921575-66921597 GTTCTGGTGCAGGGGAAGGCAGG + Intronic
1084192033 11:67503792-67503814 CCTCCGCGGCAGAGGAAGGCGGG - Intronic
1084501716 11:69539183-69539205 GGCCAGCTGCAGTGAAAGGACGG + Intergenic
1084642383 11:70433503-70433525 GGGCAGGGGCAGAGGAAGGGAGG + Intronic
1085084994 11:73661026-73661048 GGTCAGCTCGAGACGAACGCTGG - Intronic
1085228274 11:74942292-74942314 GGTCAGTTTCAGAAGAAGGGTGG + Intronic
1085449945 11:76625704-76625726 GGAGAGCTGCAGAGGAAGAGGGG + Intergenic
1086544746 11:87954659-87954681 GATCAGCTGCTCAGGAAGGCAGG + Intergenic
1086794199 11:91080470-91080492 GGGCAGCTGCAGAGTGATGCTGG + Intergenic
1086911123 11:92473963-92473985 TCTCAGCTCCATAGGAAGGCTGG - Intronic
1086916102 11:92531671-92531693 GCTGAGCCCCAGAGGAAGGCTGG - Intronic
1087766618 11:102162298-102162320 TGTCTGTTGCAGAGGGAGGCTGG + Intronic
1088504169 11:110512984-110513006 GGGAGGCTGCAGAGGAGGGCAGG - Intergenic
1088703225 11:112433575-112433597 GGTCAGCCAGAGAGAAAGGCCGG - Intergenic
1088811558 11:113395996-113396018 GGGGAGCTGGGGAGGAAGGCGGG - Intronic
1089059104 11:115611623-115611645 GGACTGCTGCGGAAGAAGGCAGG - Intergenic
1089223228 11:116893286-116893308 GGTCAGCAGGGGAGGGAGGCAGG + Intronic
1089622213 11:119728669-119728691 GGTCAGCTGCAGCCGTCGGCCGG + Exonic
1089627965 11:119763384-119763406 GGTGGGCTGCAGAGGAACACAGG - Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090640597 11:128726203-128726225 TGTCAGCTTCAGGGGAGGGCAGG - Intronic
1090873210 11:130766326-130766348 AGTGATCTGCAGGGGAAGGCAGG - Intergenic
1091095346 11:132815929-132815951 TGCTAGATGCAGAGGAAGGCAGG + Intronic
1091227299 11:133965209-133965231 GGGTAGCAGCGGAGGAAGGCAGG - Intergenic
1091983216 12:4883493-4883515 GGAGAGGTGCAGAGGAAGGATGG + Intergenic
1093726914 12:22523603-22523625 GGTGAGCTGCAGAGGAAGATTGG - Exonic
1093859910 12:24152447-24152469 GGTCAGGAGCAAAGCAAGGCTGG - Intergenic
1094052586 12:26237685-26237707 AGCCTGCTGGAGAGGAAGGCAGG + Intronic
1096193786 12:49635981-49636003 CATCAGCTGCAGAGTAAGCCTGG + Exonic
1096420436 12:51452630-51452652 GTTCACCTGCAGAAGAAGTCTGG - Intronic
1096576960 12:52558875-52558897 GTTCATCTGCTGAGGAGGGCTGG - Intergenic
1097263934 12:57735495-57735517 GGAAAGCTGCAGAGGGAGGAGGG - Intronic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1099958022 12:89370076-89370098 GGGCAGCTGCAGGTGAAGGCGGG - Intergenic
1100273121 12:93045150-93045172 GGTCATCTGCAGAGGTAGTGAGG - Intergenic
1103021084 12:117534779-117534801 GGTCCTCAGAAGAGGAAGGCAGG + Intronic
1103246687 12:119464056-119464078 GGCCAGGCGCAGAGGAAGGAAGG - Intronic
1103973635 12:124688027-124688049 GAGCAGCTGCAGAGGAGGGGCGG - Intergenic
1104729709 12:131098092-131098114 GGACAGCAGCAGAGCCAGGCCGG - Intronic
1104871850 12:132005060-132005082 GCTCAGCTGCAGAGGGTTGCGGG - Exonic
1104996885 12:132663694-132663716 GGTCAGCATTAGGGGAAGGCAGG + Intronic
1105437720 13:20391588-20391610 GGTGAGGTGGAGCGGAAGGCAGG + Intergenic
1106200597 13:27533504-27533526 GGACAGCGGCAGAGGAGGCCAGG + Intergenic
1106560483 13:30841361-30841383 GGTCAGCAGCAGAGGAATTTCGG - Intergenic
1107096767 13:36545722-36545744 GGAGAGATGCAGAAGAAGGCAGG + Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1108522587 13:51259374-51259396 GGTCAGCGGGAGTGGGAGGCAGG - Intronic
1110011028 13:70333644-70333666 GGTCACCGGCAGAGGAAGTTAGG + Intergenic
1111573523 13:90118741-90118763 GCTCAGGCACAGAGGAAGGCAGG - Intergenic
1111729538 13:92056218-92056240 GGTCAGGAGCCGAGGAAAGCAGG - Intronic
1111790165 13:92845328-92845350 GGTCAGCTGCAGACCCAGGAAGG + Intronic
1112330776 13:98475620-98475642 GGTCAGCTGCAGGCGCAGGCGGG - Intronic
1112330803 13:98475708-98475730 GGTCAGCTGCAGGCGCAGGCCGG - Intronic
1112555227 13:100461714-100461736 GAGCAGCTGCAAAGGCAGGCAGG - Intronic
1112992030 13:105525618-105525640 GGTGAGCTCAAGAGGCAGGCAGG - Intergenic
1113221004 13:108102542-108102564 AGCCAGCTAGAGAGGAAGGCTGG - Intergenic
1113440243 13:110322935-110322957 GGTCAGCTGGAGCGGGAGGGCGG + Intronic
1114710252 14:24770189-24770211 GGGCAGCTGGAGAGAAAGGTCGG + Intergenic
1115408469 14:33046294-33046316 GTGAAGCTGCAGAGGTAGGCAGG + Intronic
1115749739 14:36477390-36477412 GGACAGCTGCAGCAGAGGGCGGG + Intronic
1116898276 14:50338184-50338206 GGTAAGCACCAGAGTAAGGCTGG + Intronic
1117149312 14:52869122-52869144 GGGCAGCTGAAGAGGGAAGCAGG + Intronic
1117998696 14:61502869-61502891 GCCGAGCAGCAGAGGAAGGCAGG + Intronic
1118014276 14:61642543-61642565 AGGCAGCTGGAGAGGAAGGCAGG + Intronic
1118328870 14:64800623-64800645 GGTCAGCTTTAGAGGAAGTTGGG + Intronic
1118456162 14:65947194-65947216 GGGCTGTGGCAGAGGAAGGCTGG - Intergenic
1118590055 14:67394519-67394541 GATCAGCTGCAGATAAAGGTGGG - Intronic
1118814240 14:69298621-69298643 TGTTAGCTGGAGCGGAAGGCTGG + Intronic
1120963902 14:90150588-90150610 TGTCTGATGCACAGGAAGGCAGG + Intronic
1121157585 14:91701121-91701143 AGTCAAGTGGAGAGGAAGGCAGG + Intronic
1121414794 14:93771941-93771963 GCCCAGCTGGAGAGGAAGGGAGG - Intronic
1122029096 14:98899632-98899654 GGTCACCTGGAGAGGAAGTGTGG - Intergenic
1122599852 14:102915767-102915789 CGTCACCTGCAGAGCAAGGGTGG - Intergenic
1122606361 14:102949269-102949291 TGTCAGCTGCAGGAGCAGGCGGG - Intronic
1122608222 14:102962438-102962460 GTGCAGCTGCAGAGGAGGCCGGG + Intronic
1122838575 14:104443373-104443395 TGGCAGCTGCAGAGCAGGGCAGG + Intergenic
1123696143 15:22880495-22880517 GGCCAGCTCCAGAGCAAGGCAGG + Intronic
1124351148 15:28956392-28956414 GGACAGATGCAGAGGCAGTCAGG + Intronic
1124436157 15:29651505-29651527 GGGCAGCTGCAGAGGTACCCAGG - Intergenic
1127258888 15:57313347-57313369 GTTCAGCTCCTCAGGAAGGCAGG - Intergenic
1127866783 15:63040012-63040034 GGTCCTCTCCAGAGGTAGGCTGG - Intergenic
1128497749 15:68207832-68207854 GGTCAGGTGCAGAGGAGGGCAGG + Exonic
1129655717 15:77524563-77524585 GGTCAGATGGGGAGGAAGGAGGG - Intergenic
1129677675 15:77641242-77641264 CATCAGCTGGAGAAGAAGGCAGG - Intronic
1130807754 15:87344322-87344344 GGACAGCTTCAGAGCAAGACAGG + Intergenic
1131145140 15:90006083-90006105 GGTCTGCAGCAGAGGGAGGCTGG + Intronic
1131437438 15:92434643-92434665 GGTCAGCAGCAGAGGGAATCTGG + Intronic
1131514841 15:93070463-93070485 GGTCTGATGGAGAGCAAGGCGGG - Intronic
1131946278 15:97625634-97625656 AGTCAGCTGCAGATGGAGGTAGG + Intergenic
1132156670 15:99500607-99500629 TGTCTACTGCAAAGGAAGGCAGG + Intergenic
1132329824 15:101004499-101004521 GTTGAGCTGCAGAGGCAGCCAGG + Intronic
1132794030 16:1709717-1709739 GTGCAGCTCCAGAGGAGGGCCGG + Intronic
1133101876 16:3484906-3484928 GGTCAGATGGACAGGAAGGCGGG - Exonic
1133109157 16:3535344-3535366 GAGCAGCTGGAGAGGAAGGTGGG + Intronic
1133263484 16:4568530-4568552 GGGTAGCTGCAGTGGAAGGATGG - Intronic
1136607274 16:31344821-31344843 GCTGAGCTACAGAGGAAGCCAGG - Intergenic
1137043115 16:35631795-35631817 GCTCAGCCACAGTGGAAGGCAGG - Intergenic
1138251100 16:55502625-55502647 AGCCAGCTGCAGTGGAAGGAAGG - Intronic
1139366893 16:66439079-66439101 GGACAGCTGCAGTGGGAGGTAGG + Intronic
1139531297 16:67543956-67543978 GGGCAGCAGCAGAGGAAGGAGGG - Intronic
1139604159 16:68006041-68006063 GGTCAGCTTCACAGGAGGGCAGG - Intronic
1140575276 16:76160531-76160553 GGTCAGTAGAAGAGGGAGGCAGG - Intergenic
1140816909 16:78629581-78629603 AGTAAGCTGCAGAGGTTGGCAGG - Intronic
1141171795 16:81696314-81696336 TGTCAGCTGCACAGGAGGGAGGG - Intronic
1141389139 16:83649775-83649797 GGTCTGCTGCTGAGAGAGGCAGG + Intronic
1141390119 16:83657566-83657588 GGTCTGCTGCAGAGGAAGGTGGG - Intronic
1141489655 16:84363539-84363561 GGCCACCTGAAGATGAAGGCAGG - Intergenic
1141678068 16:85528016-85528038 GGACAGCTGCAGAGGTGGGCAGG + Intergenic
1141908803 16:87044747-87044769 AGTCAGCTGAGGAGGCAGGCTGG + Intergenic
1142043349 16:87909449-87909471 GGATAACTGCAAAGGAAGGCTGG + Intronic
1142263946 16:89055007-89055029 CAGCAGCTGCAGAGGAAGGTGGG - Intergenic
1142405394 16:89885975-89885997 GGGCAGCCGCAGAGAAGGGCGGG - Intronic
1142884396 17:2903767-2903789 GGTCAACTGCAGGGGCAGGCAGG + Intronic
1143238971 17:5427772-5427794 GGGCAGAGGCAGAGGGAGGCTGG + Intronic
1144504844 17:15821269-15821291 GGGCAGGTGGAGAGGAAGGAGGG - Intergenic
1144523351 17:15969066-15969088 CCTCAGCTGCAGTGGAAGGAAGG - Intronic
1144802049 17:17936108-17936130 GATGGGCTGCAGAGGAAGACAGG - Intronic
1145169017 17:20639152-20639174 GGGCAGGTGGAGAGGAAGGAGGG - Intergenic
1145203580 17:20968591-20968613 GGGCAGGTGGAGAGGAAGGAGGG - Intergenic
1146401400 17:32502887-32502909 GGACAGCTGCCGAGGGAGGCTGG + Intronic
1146907818 17:36629407-36629429 GGTGAGCTGCGGCGGCAGGCAGG + Intergenic
1147617002 17:41835766-41835788 GGTCCGCGGCAGAGCAAAGCGGG + Intronic
1147659214 17:42108229-42108251 TGTGAGCTCCAGAGGGAGGCCGG + Intronic
1147678156 17:42221301-42221323 GGTCCCTTGCATAGGAAGGCTGG - Intronic
1147687793 17:42297637-42297659 GGTCCCTTGCATAGGAAGGCTGG + Intronic
1148643757 17:49207185-49207207 GGTAGGATGCAGAGAAAGGCTGG - Intronic
1149530988 17:57395117-57395139 GGCCATGTGCAGATGAAGGCAGG - Intronic
1149533935 17:57417401-57417423 CATCAGCTGCAGAGCAAGGAGGG + Intronic
1151435003 17:74089692-74089714 GGTCAGCTGCAGATTGATGCTGG - Intergenic
1151436655 17:74101818-74101840 GGGGAGCTGCAGAGGAAGGGAGG - Intergenic
1152087166 17:78227325-78227347 GGGCAGGTGCTGGGGAAGGCTGG + Intergenic
1152198327 17:78930388-78930410 CGGCAGCTGTAGAGGAAGGTGGG + Intergenic
1152395558 17:80030761-80030783 GGGCAGAGGCAGAGGCAGGCAGG + Intronic
1152667443 17:81579510-81579532 GGTCAGCTGAAGGGGGAGGCTGG - Intronic
1152948512 17:83211799-83211821 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1153904951 18:9652997-9653019 GGTCAGAGGCAGAGGGAGACTGG - Intergenic
1155176346 18:23304687-23304709 GGACAGGTGCAGAGGAAGAGGGG + Intronic
1155761400 18:29572474-29572496 GGTGAACTGCAGAGGAAGGCTGG + Intergenic
1157846324 18:51007031-51007053 GGTCAGCTGCATTGCAGGGCGGG - Intronic
1158665483 18:59429025-59429047 GTGAAGCTGCAGAGGCAGGCGGG + Intergenic
1160322839 18:77912453-77912475 GCACAGCTGGAGAGGAAAGCAGG - Intergenic
1160374756 18:78403179-78403201 GAGCAGCTGCAGAGTCAGGCAGG - Intergenic
1161317421 19:3624141-3624163 GGTCAGATTCAGAGGAAGAGCGG - Exonic
1162637963 19:11985180-11985202 GGCCACCTGCAGGGGAAGGCGGG - Intergenic
1163822415 19:19503433-19503455 GTTCGGCTGCAGAGGAATCCAGG + Intronic
1164482156 19:28620095-28620117 GGGCAGCTGCAGAGGGAGCTAGG + Intergenic
1164592647 19:29514639-29514661 GGGCAGATGAAGAGGAAGGAGGG + Intergenic
1165476193 19:36032427-36032449 GGTCAGCTGGAGAGGGTGCCCGG + Intronic
1165766757 19:38356467-38356489 GGCCATCTGCAGAGCAAGGTCGG - Exonic
1166786873 19:45372803-45372825 GGGCAGCTGGAGGGGAAGGCAGG + Intergenic
1166996762 19:46723125-46723147 GGGAAGGTGCAGAGGCAGGCCGG + Exonic
1167722502 19:51187961-51187983 TTTCAGCTGTAGAGGAAGACAGG - Intergenic
1168096027 19:54115360-54115382 GCTCAGCAGCCGAGGACGGCGGG + Exonic
925695127 2:6568415-6568437 GGACAGCAGCAGAGGCAGGGAGG - Intergenic
926198609 2:10778064-10778086 GGGCAGCTGCAGTGTCAGGCGGG + Intronic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG + Intronic
927705748 2:25295330-25295352 AGTCAGCTGCAGGGCAGGGCGGG - Intronic
929413600 2:41724755-41724777 GGTCTGGTGCACAGGGAGGCTGG - Intergenic
929573489 2:43038368-43038390 GGGCAGATCCCGAGGAAGGCTGG + Intergenic
929929677 2:46243221-46243243 GGTCACCTGGAGATGAAGGTAGG - Intergenic
930052813 2:47229621-47229643 AGTGTGCTGCAGAGGAATGCTGG + Intergenic
930449774 2:51520525-51520547 GGTCACGTGAAGATGAAGGCAGG - Intergenic
931148703 2:59548282-59548304 GGCCTGCTCCATAGGAAGGCTGG + Intergenic
932576801 2:72966850-72966872 GGTCAGCTGCAGGTGAGAGCAGG - Intronic
933253562 2:80055617-80055639 GGGCAGCTACACAGCAAGGCAGG - Intronic
933471913 2:82736249-82736271 CCTCAGCTGAAGAAGAAGGCGGG - Intergenic
934036807 2:88095196-88095218 GGCCAGTAGGAGAGGAAGGCCGG - Intronic
934564101 2:95328952-95328974 GGGGAGCTGCAGAGGAGGGGAGG + Intronic
935180776 2:100689437-100689459 GGTCAGCTGCAAAAGAAAGAAGG + Intergenic
935785035 2:106541093-106541115 GGGCTGGGGCAGAGGAAGGCAGG + Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937822896 2:126331349-126331371 AGACAGCAACAGAGGAAGGCGGG + Intergenic
937975798 2:127581511-127581533 TGTCAGCTCCAGTGGAGGGCTGG + Intronic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
940104303 2:150080785-150080807 GGGCAAGGGCAGAGGAAGGCAGG + Intergenic
940492545 2:154382133-154382155 GGGCAGCTGAAGGGGAAGGCAGG - Intronic
941784370 2:169481408-169481430 GGTCTGCTGCAGAGAGAGGTTGG + Intronic
942601013 2:177641049-177641071 GGACAGTGGCAGAGGAAGGCTGG - Intronic
942708490 2:178804222-178804244 GCTCAGCTGCAGAGCCAGACTGG - Intronic
943221101 2:185106931-185106953 GGTCAGCTGGATACAAAGGCGGG + Intergenic
943317251 2:186405392-186405414 ATTCAGCTGCAGAGGAAGTATGG - Intergenic
945023724 2:205600054-205600076 GTTCAGCTTCAGAGAAGGGCAGG - Intronic
945319139 2:208401597-208401619 GGTGTGCTGCAGAGGAAGAAGGG - Intronic
946154340 2:217797350-217797372 GGCCAGCTGCAGAGGGATGTAGG - Intergenic
946456146 2:219828040-219828062 GGACAGCTGCAGAAGAACCCTGG - Intergenic
946949672 2:224859838-224859860 GCACAGCATCAGAGGAAGGCCGG - Intronic
1168849388 20:966119-966141 GATCAGCTGCTCAGGGAGGCTGG + Intronic
1168889617 20:1286375-1286397 GATCAGCTGCTGAGGACAGCAGG + Intronic
1170614347 20:17936960-17936982 GATCAGCTTCATAGGAAGGCAGG + Intergenic
1170894364 20:20400361-20400383 GGACAGCTGGACAGGAAGGGAGG + Intronic
1171011685 20:21512627-21512649 CGTCAGGCGTAGAGGAAGGCAGG - Intronic
1171345726 20:24464812-24464834 TGCCAGCTTCAGAGGCAGGCCGG - Intergenic
1171770554 20:29319657-29319679 GGTCAGCTGAAAGGGAAGACAGG - Intergenic
1172385462 20:34531059-34531081 GGGTAGCAGCAGAGGATGGCAGG - Intronic
1172773929 20:37396560-37396582 AGCCAGCTGCAGAGAAAGGCGGG - Intronic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1173860144 20:46277890-46277912 CGGTAGCTGGAGAGGAAGGCAGG + Intronic
1174161994 20:48557717-48557739 GGTCAGCTAAGGAGGAAGGAGGG + Intergenic
1174528516 20:51192592-51192614 GGTCGGCTGGAGGGGAAGGGAGG - Intergenic
1174592731 20:51658952-51658974 GGACAGCTGGAGATGCAGGCAGG - Intronic
1175161087 20:57008470-57008492 AGTCAGCTGCAGAGGTGGGTGGG + Intergenic
1175356476 20:58372982-58373004 GGACAGCTGAGGAGGCAGGCGGG + Intergenic
1175385436 20:58591981-58592003 GGCCAGCAGCTGAGGAATGCAGG + Intergenic
1175391339 20:58629321-58629343 TGTCATCTGCAGAGGCTGGCTGG - Intergenic
1176414729 21:6467824-6467846 GCTCAGGCGAAGAGGAAGGCGGG - Intergenic
1176613802 21:9011120-9011142 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1178345940 21:31828065-31828087 GGGAAGATGCAGAGGAAGGAAGG + Intergenic
1178842822 21:36151583-36151605 GGACAGCTCCAGGTGAAGGCAGG - Intergenic
1179690229 21:43076146-43076168 GCTCAGGCGAAGAGGAAGGCGGG - Intronic
1180065232 21:45409004-45409026 GGTCAGGTGCAGAGGCTGGCAGG + Intronic
1180921414 22:19523416-19523438 GGTCAGCTGCGGGCGCAGGCAGG + Exonic
1181359935 22:22326821-22326843 GGGCTACTGGAGAGGAAGGCAGG - Intergenic
1181369959 22:22408250-22408272 GGGCTACTGGAGAGGAAGGCAGG - Intergenic
1181411910 22:22730117-22730139 GGTCAGCTGAAGGGCAAGGAAGG - Intergenic
1181638974 22:24187079-24187101 GGGCACCTGCAGGGGAAGGGAGG - Intronic
1182151822 22:28032920-28032942 TGTCAGCTGAACAGGCAGGCAGG + Intronic
1182283407 22:29231003-29231025 GGTCATCTGAAGAGGAAGACAGG - Exonic
1182444323 22:30381212-30381234 GGGCAGCTGCAAGGGAACGCTGG - Intronic
1182550570 22:31098840-31098862 GGTGAGCTGCAGAAGTGGGCTGG + Exonic
1182756899 22:32687653-32687675 GGTGAGCTCAAGAGGGAGGCGGG - Intronic
1183240228 22:36652366-36652388 GGAGGGCTGCAGAGGTAGGCAGG - Intronic
1183248656 22:36712794-36712816 GATCAGCTGGAAAGGGAGGCGGG + Intergenic
1183482047 22:38070560-38070582 TGACAGCTGGGGAGGAAGGCTGG - Intronic
1183536611 22:38405286-38405308 GGCCATTTGCAGAGGCAGGCTGG - Intergenic
1183686305 22:39363186-39363208 GGGGAGCTTCAGAGGAAGGCAGG + Intronic
1183984222 22:41560753-41560775 GGGCAGCTGCTGAGGAATGCAGG - Exonic
1184355818 22:43978963-43978985 TGGCAGGGGCAGAGGAAGGCAGG - Intronic
1184561055 22:45263115-45263137 GGGCAGCTGCAGCGGCATGCAGG + Intergenic
1184647566 22:45904360-45904382 GGTAAGTTGCAGTGCAAGGCTGG - Intergenic
1184654408 22:45933914-45933936 GGCCAGCTGCTGGGGAGGGCTGG + Intronic
1184756114 22:46516884-46516906 GGTCAGCTGCAGTGGGAAACGGG - Intronic
1184916821 22:47575036-47575058 CCTCAGCTCCAGAGGAAGGAGGG - Intergenic
1185105601 22:48867858-48867880 GGCCGTCTGCAGGGGAAGGCAGG + Intergenic
1185335302 22:50268603-50268625 GGTCACCTGCAAAGGGAGGGTGG - Intronic
1185382087 22:50514169-50514191 AGGCAGCTGGAGAGGGAGGCTGG + Intronic
1185410267 22:50678088-50678110 GGTGAGCTGGAGAGGAAGATGGG + Intergenic
949940594 3:9151371-9151393 GGGCAGCTGGAGAGGCAGCCTGG + Intronic
950024055 3:9808779-9808801 GGTCAGCTGGACAGGAAGGTGGG + Intronic
950968552 3:17163980-17164002 AATCAGCTGCAGTAGAAGGCAGG - Intronic
951916432 3:27805510-27805532 TGTGTGCTGCACAGGAAGGCTGG - Intergenic
952015990 3:28958575-28958597 GGGCAGCTGCAGAGGCACCCGGG - Intergenic
954321222 3:49833215-49833237 GGTAAACTCAAGAGGAAGGCAGG + Intronic
954702502 3:52457660-52457682 GGTCAGGTGCAGAGGCTGGTGGG + Intronic
954751092 3:52814099-52814121 GGTCAGAGACAGAGGAAGCCTGG + Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956315190 3:67927553-67927575 GGTCAGTTCCAGAGCAATGCAGG + Intergenic
956672322 3:71702894-71702916 GGTCTGCTACAGCGGAAGCCTGG + Intronic
961580202 3:127874724-127874746 CTTCATCTGCAGAGGAAGCCAGG + Intergenic
962374276 3:134847222-134847244 GGACAGCAGCAGGGCAAGGCGGG + Intronic
962448864 3:135494603-135494625 AGTCAACTGCAGAGGAAGCTGGG + Intergenic
964245066 3:154642238-154642260 TGGCAGCTTGAGAGGAAGGCTGG - Intergenic
964250782 3:154714241-154714263 GGTCACGTGCAGAGGAGTGCAGG + Intergenic
964452707 3:156826795-156826817 GGTCAGGGGCAGGTGAAGGCGGG - Exonic
964751731 3:160059901-160059923 GGTCAGTTTCAGAGAAAGTCAGG + Intergenic
964922597 3:161915483-161915505 GATCAGCTGCCGTGGAAGACAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966509710 3:180748224-180748246 GGTGAGTTGCAGAGGAGGACTGG - Intronic
966567161 3:181396326-181396348 GGACAACAGCAGAGCAAGGCTGG + Intergenic
966808992 3:183827000-183827022 GGTCAGCATGAGAGGGAGGCAGG + Intergenic
966880430 3:184346850-184346872 GCTCACCTGGGGAGGAAGGCGGG - Intronic
967367166 3:188700341-188700363 GGTCAGCCCCAGAGGAACTCAGG + Intronic
968485868 4:861292-861314 CGTCAAAAGCAGAGGAAGGCCGG + Intronic
968573199 4:1353247-1353269 GGTGGCCTGCAGAGGCAGGCAGG - Exonic
968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG + Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
969098205 4:4750275-4750297 GGTCAGCCGCAGGGGAGGGGAGG - Intergenic
969207595 4:5658842-5658864 GGTCAGGCCCAGAGTAAGGCTGG + Intronic
969363553 4:6680845-6680867 TGCAAGATGCAGAGGAAGGCAGG - Intergenic
969870193 4:10099708-10099730 GGGAAGCTGCACAGGAAGCCCGG - Intronic
970334570 4:15021970-15021992 GGTCAGCTGAAGAGAAAGAGAGG - Intronic
974397643 4:61359449-61359471 GGGCGGCTGCAGAGGGAGGGAGG - Intronic
974408665 4:61509843-61509865 GTTCAGCTGCTGTGGAAAGCAGG - Intronic
975307898 4:72869611-72869633 GGGCAGCTAGACAGGAAGGCTGG + Intergenic
976506317 4:85851853-85851875 GGTCAGCCAGAGAGAAAGGCTGG - Intronic
977248389 4:94660767-94660789 CCTCAGCTGGAGAGGAAGGCAGG - Intronic
978754292 4:112285962-112285984 GGTCACCTCGAGAGGAAGGAAGG - Intronic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983517750 4:168675244-168675266 GGTCAGGAGGAGAGGAGGGCAGG + Intronic
983531031 4:168809991-168810013 GGTCAGCCTCTGAGGAAGACAGG + Intronic
984802351 4:183726746-183726768 GGGCAGTTCCAGAGGCAGGCAGG + Intergenic
985406808 4:189646211-189646233 GAACAGATGCTGAGGAAGGCGGG + Intergenic
985406844 4:189646391-189646413 GAACAGATGCTGAGGAAGGCGGG + Intergenic
985651274 5:1108891-1108913 GGCCAGGGGCAGAGGGAGGCAGG + Intronic
986009405 5:3698656-3698678 GCTCAGCTGGAGAGGCTGGCTGG - Intergenic
987309210 5:16666685-16666707 GGGCAGCTCCAGGTGAAGGCGGG - Exonic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
989188281 5:38645497-38645519 TGTCAGGAGCTGAGGAAGGCAGG + Intergenic
990603707 5:57386270-57386292 GGCCAGCTGCTGAGGATGTCAGG + Intergenic
990993519 5:61708207-61708229 GGTCAGCAGCAGATGGGGGCAGG + Intronic
992066408 5:73113890-73113912 GGACAGGTGCACAGGGAGGCTGG - Intergenic
994510805 5:100701283-100701305 GGCCAGCCGGAGAGGAAGGTCGG + Intergenic
995534230 5:113119392-113119414 AGACAGCTGCCGAGGAAGGAGGG + Intronic
995588362 5:113672621-113672643 AGTCAGATTCTGAGGAAGGCAGG + Intergenic
997000568 5:129754164-129754186 GGTTATCTGCAGGGAAAGGCAGG + Intronic
997504720 5:134408165-134408187 GGGCAGGGGCAGAGGTAGGCAGG - Intronic
997642583 5:135459071-135459093 GGTTGGGTGCAGAGGAAGCCAGG - Intergenic
997898435 5:137740989-137741011 GATAAGCTGTAGAAGAAGGCTGG - Intergenic
998148197 5:139742386-139742408 TGTCAGCTGCAGGGAAAGGCTGG - Intergenic
998215923 5:140238737-140238759 GCTCAGATGCAGAGGTAGGAAGG - Intronic
999095442 5:148973917-148973939 GTGCAGCTGGAGAGGCAGGCAGG - Intronic
999255663 5:150208850-150208872 GGTCAGAGGCAGAAGGAGGCAGG + Intronic
1000635091 5:163634967-163634989 GGTCACCTGAACAGTAAGGCTGG + Intergenic
1001057297 5:168460276-168460298 GGTCAGCCGCACAGCAGGGCTGG - Intronic
1002320775 5:178374384-178374406 GGGCAGCAGCAGAGATAGGCAGG - Intronic
1002742679 5:181444954-181444976 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1002742689 5:181444993-181445015 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1003478184 6:6504709-6504731 GGGCAGCTTCAGTGGAAGACAGG - Intergenic
1003631272 6:7789969-7789991 GGTCTGCTGCAGGAGCAGGCTGG + Intronic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1003813183 6:9807709-9807731 GGGGAGCAGCAGGGGAAGGCAGG + Intronic
1005161886 6:22873672-22873694 AGACAGCTGCAGAGGAAGCAGGG + Intergenic
1005398466 6:25407449-25407471 GTACAGCTGCAGATGCAGGCAGG + Intronic
1006100330 6:31682419-31682441 GGAGAACTGCAGAGGAACGCGGG + Intronic
1007262788 6:40575467-40575489 GGGCAGGCGCAGAGTAAGGCTGG - Intronic
1007589368 6:43012173-43012195 GGCCAGGGGCTGAGGAAGGCCGG + Exonic
1007720853 6:43884764-43884786 GGTCAGCAGCAGGGGCAGGCAGG - Intergenic
1008598434 6:53065674-53065696 GCTCCGCTGCAGAGACAGGCAGG + Intronic
1008936670 6:56999644-56999666 GCTTAGCTGCAGGGGAAGGAGGG - Intronic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1012126389 6:95433819-95433841 GGTCAGCTGTGGAAGAAGGAAGG - Intergenic
1013086902 6:106864525-106864547 GGGCAGCTGCAGAGGCACCCAGG + Intergenic
1014344121 6:120245914-120245936 GTTCAGTTGCAGATGAAGGATGG - Intergenic
1015334340 6:132020243-132020265 GGCCAGGCTCAGAGGAAGGCGGG - Intergenic
1017234801 6:152108290-152108312 GGTCAGCAACAGAACAAGGCAGG - Intronic
1018093978 6:160368534-160368556 GCTCAGCTGCAGAGGAACACAGG - Intronic
1018169444 6:161132859-161132881 GGTCAGCTACAGACACAGGCGGG + Exonic
1018292837 6:162310427-162310449 GGTCAGGAGCTGAGGAAAGCAGG + Intronic
1018947109 6:168355770-168355792 GGTCAGCTCCAGAGAGATGCAGG - Intergenic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019247814 6:170720693-170720715 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019247824 6:170720732-170720754 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019416961 7:932262-932284 GGAAGGCTGGAGAGGAAGGCTGG - Intronic
1019428576 7:988402-988424 GCTGACCTGCAGAGAAAGGCAGG - Exonic
1019430455 7:996638-996660 GGGCAGCTGCCGGGGAGGGCCGG - Intergenic
1019449724 7:1091161-1091183 GCTCAGCTGCAGCTGGAGGCTGG - Intronic
1020106023 7:5422693-5422715 GGGAGGCTGGAGAGGAAGGCCGG - Intronic
1020444408 7:8254415-8254437 GGTCAGCAGCAAAGGGAAGCAGG + Intronic
1021215936 7:17915253-17915275 GGTCAGCTGCATAGAGGGGCGGG - Intronic
1021604216 7:22394140-22394162 GGTCATGTGCAGGGAAAGGCTGG - Intergenic
1022237002 7:28471691-28471713 GATCATCTGCAGAGTGAGGCAGG + Intronic
1024544155 7:50502988-50503010 GGTCAGCAGCTGGGGAAGGCCGG - Intronic
1024587653 7:50855513-50855535 GCTCTGCTGCAGAGTGAGGCTGG - Intergenic
1025014015 7:55424297-55424319 GGTCAGCTGCAGAGACAGGCAGG - Intronic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1025711450 7:63914136-63914158 GGTTAGGTGGTGAGGAAGGCAGG + Intergenic
1026011273 7:66638437-66638459 GGTCAGCTGCCCAGGATGGTGGG + Intronic
1026837017 7:73646354-73646376 TGTCAGCTGAAGTGGAGGGCTGG - Intergenic
1026845522 7:73697000-73697022 GAGCAGCTGCAGAGCAGGGCTGG - Intronic
1028582682 7:92423539-92423561 AGTCATCTGGAGAGGAAGGCTGG - Intergenic
1029178983 7:98685734-98685756 GGGCAGCTGCAGGGAAGGGCGGG + Intergenic
1029218483 7:98969643-98969665 GCCCAACTGCAGAGGCAGGCAGG + Intronic
1029473275 7:100767814-100767836 ATTCAGCTGCAGAGGCAGGGAGG - Exonic
1029495586 7:100894341-100894363 GCTCAGCTGCAGAGGAGGTGGGG + Intronic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1029851351 7:103464746-103464768 ATACAGCTGGAGAGGAAGGCAGG + Intergenic
1032991619 7:137400669-137400691 TGTCAGCTGCAGAGGATGAAAGG - Intronic
1033525799 7:142211928-142211950 GGTCAGCCAGAGAGGAAGGTTGG + Intronic
1034034994 7:147809864-147809886 TGTGAGGTGCTGAGGAAGGCTGG + Intronic
1034489783 7:151387065-151387087 GGTCAGCTCCAGAGCCAGCCAGG + Intronic
1034698745 7:153078134-153078156 TGTCAGCTGAAGAGGACGGGAGG + Intergenic
1035161031 7:156950023-156950045 CGCCGGCTGCAGAGGACGGCGGG + Exonic
1035251427 7:157599962-157599984 GGGCAGGTGGAGAGGTAGGCAGG - Intronic
1035251456 7:157600058-157600080 GGGCAGGTGGAGAGGTAGGCAGG - Intronic
1035251483 7:157600152-157600174 GGGCAGGTGGAGAGGTAGGCAGG - Intronic
1035251507 7:157600232-157600254 GGGCAGGTGGAGAGGTAGGCAGG - Intronic
1035255619 7:157624505-157624527 GCCCAGCAGCAGAGGAAGGTAGG - Intronic
1035500293 8:87132-87154 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
1035500303 8:87171-87193 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
1035524522 8:301826-301848 TGGCACCTGCAAAGGAAGGCTGG - Intergenic
1035557959 8:580402-580424 GGGCCGTTGCAGAGGGAGGCAGG - Intergenic
1036719128 8:11156408-11156430 GCCCAGCTGAAGAGGCAGGCAGG - Intronic
1036747490 8:11420245-11420267 AGGCAGCTGCAGAGGCTGGCGGG - Intronic
1038968858 8:32608498-32608520 AGTCAGATACAGAGTAAGGCTGG - Intronic
1039968302 8:42299635-42299657 GGTCACGTGCAGAGGTTGGCAGG - Intronic
1040388569 8:46931339-46931361 TTGCAGCTGCAGAGGCAGGCAGG - Intergenic
1041016116 8:53594566-53594588 GCTGAGCTGCAGGGCAAGGCGGG - Intergenic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1041552001 8:59113565-59113587 GGTAAGCTGAAGAGGGAGCCAGG + Intronic
1042228875 8:66537160-66537182 GGTCAGCTCCTGAGGGAGGGAGG + Intergenic
1044544635 8:93445943-93445965 TCTCAGCTGCAAAGGAAGGGAGG - Intergenic
1044892819 8:96855336-96855358 AGGCAGCTGCTGAGGAGGGCTGG + Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1047044524 8:121037237-121037259 GGCCATCTGAAGAGGAATGCAGG + Intergenic
1047446158 8:124921564-124921586 GGTCAGCTGCACTGAGAGGCAGG + Intergenic
1048432380 8:134382237-134382259 TGCCTGCTGCAGAGGAAGGAAGG - Intergenic
1049277170 8:141725710-141725732 GAGCAGCTGCAGAGGGAGGGAGG - Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049555012 8:143277377-143277399 GGGCTGGTGCAGAGGAAGCCCGG - Intergenic
1049742631 8:144248436-144248458 TGTCTCCTGCAGAGGAAGGAGGG + Intronic
1050277792 9:4018132-4018154 AGTCATCTGAAAAGGAAGGCAGG + Intronic
1051357418 9:16252713-16252735 CGTTAGCTGAAGAGGCAGGCGGG - Intronic
1051671216 9:19512541-19512563 GGTCAGGTGCAGAGGGCAGCTGG + Exonic
1052834790 9:33242248-33242270 GCTCAGGTGCATAGGGAGGCGGG + Intronic
1052979790 9:34439777-34439799 GATAAGCTGAAGAGGAAGGCAGG + Intronic
1053044648 9:34905220-34905242 GACCAGCTGCAGAGGCAGGGAGG + Intergenic
1053648378 9:40138460-40138482 GGTGAGTTGCAGAGGGAGACTGG + Intergenic
1053757360 9:41325381-41325403 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1054329356 9:63736403-63736425 GGTGAGTTGCAGAGGGAGACTGG + Intergenic
1054536202 9:66237710-66237732 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1054812556 9:69446599-69446621 TGGCAGCTGCAGAGGGAGTCAGG + Intronic
1055370312 9:75591412-75591434 GGTCATCGGCAGTGGAATGCAGG - Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056530265 9:87480433-87480455 GGACACCTCCAGGGGAAGGCAGG + Intergenic
1057294435 9:93827148-93827170 GGTGAGGTGCTGAGGGAGGCGGG + Intergenic
1057925017 9:99138670-99138692 GGTCAGATGCTGAAGAAGGAAGG + Intronic
1058677608 9:107413804-107413826 AGTCAGCAGCAGAGGAAAGGGGG - Intergenic
1058968195 9:110056235-110056257 AGTCAGCTGCACTGGGAGGCGGG - Intronic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059822944 9:117994229-117994251 GGAGAGCTGGAGAGGAAGGAGGG - Intergenic
1060151875 9:121294161-121294183 GCAGAGCTGCAGGGGAAGGCAGG - Intronic
1060265122 9:122107531-122107553 GGGAGGCTGCAGAGGCAGGCAGG + Intergenic
1060417054 9:123438296-123438318 GATTAGCTGCAGAGGGAGGGGGG - Intronic
1060495424 9:124115012-124115034 GGACAGCTGGGGAGGAGGGCTGG - Intergenic
1060875011 9:127077017-127077039 GAGCAGCTGCAGTGGAAGGGAGG + Intronic
1061239207 9:129359319-129359341 GCTACGCTGCAGAGAAAGGCGGG - Intergenic
1061288423 9:129637392-129637414 GTGCAGCTGGAGAGGAAGCCTGG - Exonic
1061433225 9:130544432-130544454 GGTTTGCTCCTGAGGAAGGCTGG + Intergenic
1061489333 9:130936552-130936574 AGGGAGCAGCAGAGGAAGGCGGG + Intronic
1061999311 9:134207832-134207854 GGACAGCTGGAGAGGATGGGGGG - Intergenic
1062119774 9:134827991-134828013 GGCCAGCTCAAGAAGAAGGCTGG + Intronic
1062452624 9:136621913-136621935 CATCTGCTGCAGAGGAAGGAAGG - Intergenic
1203608586 Un_KI270748v1:76173-76195 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1203608596 Un_KI270748v1:76212-76234 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1187020239 X:15373904-15373926 GAACATCTGCTGAGGAAGGCCGG - Intronic
1187223810 X:17356264-17356286 GTCCAGCTGGAGAGGAAGGAGGG + Intergenic
1187833204 X:23404016-23404038 GGTCAGATGGAGAGGAACGGTGG - Exonic
1189199882 X:39184766-39184788 GGGCAGCTGGAGAGAAAGGTCGG - Intergenic
1189583147 X:42429266-42429288 GGGCAGCTACAGAGAAAGGTCGG - Intergenic
1190071800 X:47285736-47285758 GCTCAGGCACAGAGGAAGGCAGG - Intergenic
1190072986 X:47293964-47293986 GCTCAGGCACAGAGGAAGGCAGG - Intergenic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1192204813 X:69088797-69088819 GGGCAAGAGCAGAGGAAGGCTGG + Intergenic
1192673256 X:73168448-73168470 GGTTACCTGCAGAAGATGGCAGG + Intergenic
1192795791 X:74422962-74422984 AGTCAGCTCCAGGGGAAAGCTGG - Intronic
1193056336 X:77155291-77155313 AGGCAGCTAGAGAGGAAGGCCGG + Intergenic
1195206473 X:102604575-102604597 GGACAGCTGCACAGGAAGTGTGG + Intergenic
1198053848 X:132974874-132974896 TGTCACATGCAGAGGAAGACAGG - Intergenic
1198641359 X:138759597-138759619 CTTCAGCTACAGAGTAAGGCAGG - Intronic
1198871709 X:141182800-141182822 GGTATGCTGCAGATGAAAGCAGG + Intergenic
1199546583 X:149012605-149012627 GGACAGCTGGAGAGCAAGGCAGG - Intergenic
1199680496 X:150221235-150221257 GGAGGGCTGCAGAGGAGGGCTGG - Intergenic
1199838631 X:151620469-151620491 GGTCAGCTGAAAATGAAGGAAGG + Intronic
1200093462 X:153646708-153646730 GGTCTGCTGCAGGGCTAGGCAGG - Intronic
1200146039 X:153926951-153926973 GTGCAGCTGCAGGGGAAGGGAGG - Intronic
1200684164 Y:6245183-6245205 GCTCTGCTGGAGAGGACGGCCGG - Intergenic
1201048471 Y:9909203-9909225 GCTCTGCTGGAGAGGACGGCCGG + Intergenic
1201063786 Y:10070209-10070231 GCTCTGCTGGAGAGGAAGGCCGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic