ID: 1077283158

View in Genome Browser
Species Human (GRCh38)
Location 11:1754496-1754518
Sequence ATGTGGGGATGGAGGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2667
Summary {0: 1, 1: 2, 2: 37, 3: 388, 4: 2239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077283158 Original CRISPR ATGTGGGGATGGAGGGATGG AGG Intronic
Too many off-targets to display for this crispr