ID: 1077286623

View in Genome Browser
Species Human (GRCh38)
Location 11:1768896-1768918
Sequence GCTCTAATCAGACTTGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077286617_1077286623 -9 Left 1077286617 11:1768882-1768904 CCACCCCGCCAGGCGCTCTAATC No data
Right 1077286623 11:1768896-1768918 GCTCTAATCAGACTTGAAGGAGG No data
1077286612_1077286623 22 Left 1077286612 11:1768851-1768873 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1077286623 11:1768896-1768918 GCTCTAATCAGACTTGAAGGAGG No data
1077286615_1077286623 18 Left 1077286615 11:1768855-1768877 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1077286623 11:1768896-1768918 GCTCTAATCAGACTTGAAGGAGG No data
1077286614_1077286623 19 Left 1077286614 11:1768854-1768876 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1077286623 11:1768896-1768918 GCTCTAATCAGACTTGAAGGAGG No data
1077286610_1077286623 28 Left 1077286610 11:1768845-1768867 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1077286623 11:1768896-1768918 GCTCTAATCAGACTTGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077286623 Original CRISPR GCTCTAATCAGACTTGAAGG AGG Intergenic
No off target data available for this crispr