ID: 1077289308

View in Genome Browser
Species Human (GRCh38)
Location 11:1781602-1781624
Sequence CAGGAGGGCACTGCCTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077289308_1077289323 29 Left 1077289308 11:1781602-1781624 CCCACACAGGCAGTGCCCTCCTG No data
Right 1077289323 11:1781654-1781676 CACTGCTGAGACCATGACAAGGG No data
1077289308_1077289324 30 Left 1077289308 11:1781602-1781624 CCCACACAGGCAGTGCCCTCCTG No data
Right 1077289324 11:1781655-1781677 ACTGCTGAGACCATGACAAGGGG No data
1077289308_1077289322 28 Left 1077289308 11:1781602-1781624 CCCACACAGGCAGTGCCCTCCTG No data
Right 1077289322 11:1781653-1781675 CCACTGCTGAGACCATGACAAGG No data
1077289308_1077289312 -9 Left 1077289308 11:1781602-1781624 CCCACACAGGCAGTGCCCTCCTG No data
Right 1077289312 11:1781616-1781638 GCCCTCCTGCCTCTTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077289308 Original CRISPR CAGGAGGGCACTGCCTGTGT GGG (reversed) Intergenic
No off target data available for this crispr