ID: 1077293538

View in Genome Browser
Species Human (GRCh38)
Location 11:1812841-1812863
Sequence TGAACATACAAAAAATCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077293538_1077293542 -6 Left 1077293538 11:1812841-1812863 CCAGCTGATTTTTTGTATGTTCA No data
Right 1077293542 11:1812858-1812880 TGTTCAGTAGAGATGGGGTTTGG No data
1077293538_1077293546 27 Left 1077293538 11:1812841-1812863 CCAGCTGATTTTTTGTATGTTCA No data
Right 1077293546 11:1812891-1812913 GCTTCTTTAGACCATGGCTGGGG No data
1077293538_1077293543 21 Left 1077293538 11:1812841-1812863 CCAGCTGATTTTTTGTATGTTCA No data
Right 1077293543 11:1812885-1812907 TCTCATGCTTCTTTAGACCATGG No data
1077293538_1077293545 26 Left 1077293538 11:1812841-1812863 CCAGCTGATTTTTTGTATGTTCA No data
Right 1077293545 11:1812890-1812912 TGCTTCTTTAGACCATGGCTGGG No data
1077293538_1077293544 25 Left 1077293538 11:1812841-1812863 CCAGCTGATTTTTTGTATGTTCA No data
Right 1077293544 11:1812889-1812911 ATGCTTCTTTAGACCATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077293538 Original CRISPR TGAACATACAAAAAATCAGC TGG (reversed) Intergenic
No off target data available for this crispr