ID: 1077293546

View in Genome Browser
Species Human (GRCh38)
Location 11:1812891-1812913
Sequence GCTTCTTTAGACCATGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077293538_1077293546 27 Left 1077293538 11:1812841-1812863 CCAGCTGATTTTTTGTATGTTCA No data
Right 1077293546 11:1812891-1812913 GCTTCTTTAGACCATGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077293546 Original CRISPR GCTTCTTTAGACCATGGCTG GGG Intergenic
No off target data available for this crispr