ID: 1077294515

View in Genome Browser
Species Human (GRCh38)
Location 11:1819424-1819446
Sequence GCTGGGGAAGACTCCACTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077294509_1077294515 2 Left 1077294509 11:1819399-1819421 CCAGGCTGGGCTCCTCTCTGGAG No data
Right 1077294515 11:1819424-1819446 GCTGGGGAAGACTCCACTCTCGG No data
1077294514_1077294515 -10 Left 1077294514 11:1819411-1819433 CCTCTCTGGAGGTGCTGGGGAAG No data
Right 1077294515 11:1819424-1819446 GCTGGGGAAGACTCCACTCTCGG No data
1077294503_1077294515 28 Left 1077294503 11:1819373-1819395 CCTCACTGGCTGAGAGCAGATGC No data
Right 1077294515 11:1819424-1819446 GCTGGGGAAGACTCCACTCTCGG No data
1077294507_1077294515 6 Left 1077294507 11:1819395-1819417 CCAGCCAGGCTGGGCTCCTCTCT No data
Right 1077294515 11:1819424-1819446 GCTGGGGAAGACTCCACTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077294515 Original CRISPR GCTGGGGAAGACTCCACTCT CGG Intergenic
No off target data available for this crispr